ID: 968798317

View in Genome Browser
Species Human (GRCh38)
Location 4:2724570-2724592
Sequence CAAGGTGTGAACGCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968798317_968798318 -6 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798318 4:2724587-2724609 ACCTTGTAATCCCAGCTCTTTGG 0: 2
1: 56
2: 1289
3: 28962
4: 348008
968798317_968798323 4 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798323 4:2724597-2724619 CCCAGCTCTTTGGGAGGCTGAGG 0: 658
1: 92149
2: 314917
3: 445517
4: 394031
968798317_968798326 10 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798326 4:2724603-2724625 TCTTTGGGAGGCTGAGGTGGAGG 0: 9
1: 549
2: 2196
3: 5059
4: 9346
968798317_968798327 26 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798327 4:2724619-2724641 GTGGAGGATCACTTGAGCCCAGG 0: 71
1: 1110
2: 19428
3: 58109
4: 146148
968798317_968798325 7 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798325 4:2724600-2724622 AGCTCTTTGGGAGGCTGAGGTGG 0: 382
1: 63443
2: 166887
3: 186823
4: 139282
968798317_968798320 -5 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798320 4:2724588-2724610 CCTTGTAATCCCAGCTCTTTGGG 0: 3
1: 492
2: 18893
3: 329837
4: 352707
968798317_968798321 -2 Left 968798317 4:2724570-2724592 CCAGGCACAGCGTTCACACCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 968798321 4:2724591-2724613 TGTAATCCCAGCTCTTTGGGAGG 0: 1775
1: 298238
2: 328399
3: 307186
4: 311163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968798317 Original CRISPR CAAGGTGTGAACGCTGTGCC TGG (reversed) Intronic
900532014 1:3159120-3159142 CAAGGTCTCAAGGCTGTCCCTGG - Intronic
900829448 1:4955515-4955537 CAAGCTTTGAAAGGTGTGCCAGG - Intergenic
901514997 1:9739296-9739318 CAAGTTGTGAGGGCTGTGCGAGG - Intronic
902303846 1:15522420-15522442 TAAGATGTGAAAGCTGGGCCGGG + Intronic
903117112 1:21187434-21187456 ATAGGTGTGAGCACTGTGCCTGG - Intergenic
906292413 1:44627876-44627898 CAAGCTCTGCACCCTGTGCCAGG - Intronic
908577615 1:65477596-65477618 AAAGGAGTGTACACTGTGCCTGG + Intronic
908834830 1:68218551-68218573 CTAGGTGTGTACTCTTTGCCAGG + Intronic
909248047 1:73313852-73313874 CAAGGTTTTAAAGCTGTGCTTGG - Intergenic
912637904 1:111315613-111315635 CAACATGTGAGCTCTGTGCCAGG + Intronic
912846490 1:113079406-113079428 ACAGGTGTGAGCACTGTGCCCGG - Intronic
921183183 1:212647206-212647228 CGGGGTGTGAACTCTGTGCTGGG - Intergenic
922598506 1:226832470-226832492 ACAGGTGTGAGCCCTGTGCCCGG + Intergenic
923722162 1:236476407-236476429 ACAGGTGTGAGCCCTGTGCCTGG - Intronic
923922386 1:238582230-238582252 CATGGAGAGAAAGCTGTGCCAGG + Intergenic
1065188899 10:23193130-23193152 CAAGGTGGACACGCTGCGCCTGG + Exonic
1065641867 10:27791323-27791345 AAAGGTGTGAACACTGGGACGGG - Intergenic
1066292943 10:34030286-34030308 ACAGGTGTGACCACTGTGCCTGG + Intergenic
1069616976 10:69812546-69812568 CAAGGTGTGGGCTCTGAGCCAGG + Intronic
1071466720 10:85947307-85947329 CAAGCTGTGAACACGGAGCCTGG + Intronic
1072245022 10:93535624-93535646 CAGAGTTTGAACGCTGTGCTGGG - Intergenic
1074300494 10:112228756-112228778 ACAGGTGTGAGCCCTGTGCCCGG - Intergenic
1075718554 10:124571538-124571560 AAAGCTGTGGACCCTGTGCCTGG + Intronic
1075861821 10:125683608-125683630 CATGGTCTCAATGCTGTGCCAGG - Intergenic
1076503263 10:130953600-130953622 CAAGGTGTGATCCTTGTGTCTGG - Intergenic
1077039886 11:515559-515581 ACAGGTGTGAGCACTGTGCCTGG - Intergenic
1078236826 11:9492540-9492562 TAAAGTGTGTAGGCTGTGCCAGG - Intronic
1078854684 11:15197463-15197485 CAAGGTGAGGATGCTGTGCAGGG - Intronic
1079100718 11:17540332-17540354 CAGGGCGTGATTGCTGTGCCAGG - Intronic
1081917097 11:46739305-46739327 CATGGGGTGAAGGCTGTGACCGG + Exonic
1083372606 11:62193826-62193848 CTAGGTGGGAACCCTGGGCCTGG - Intergenic
1083779995 11:64912867-64912889 ACAGGTGTGAACCCTGTGCCTGG + Intronic
1084311143 11:68317045-68317067 CAGGGTGTGGGCTCTGTGCCAGG + Intronic
1086085975 11:82955895-82955917 CAAAGCTTGAACGCTGTGCTGGG + Intronic
1087326313 11:96727637-96727659 CAGAGTTTGAACGCTGTGCTTGG + Intergenic
1087442719 11:98207309-98207331 CAAGGTGTGCCAGCTGTGGCAGG + Intergenic
1088857349 11:113768042-113768064 CAAGGTGTGAATCTCGTGCCTGG - Intronic
1092581620 12:9849101-9849123 CAGGGCTTGAACGCTGTGCTGGG + Intergenic
1096870331 12:54588621-54588643 CGAGCTGGGAGCGCTGTGCCGGG - Exonic
1100568098 12:95818228-95818250 ACAGGTGTGAACACTGTGCCTGG - Intronic
1102484119 12:113244570-113244592 CATGGTGGCAACGCTGTGCCTGG + Intronic
1107024369 13:35784743-35784765 CAGAGTGAGAACGCTGTCCCCGG - Intronic
1110722686 13:78782514-78782536 CTAGGTGTTAACACTGTGTCTGG - Intergenic
1111648211 13:91058294-91058316 CCAGGAGTGAAAGCTGTGCCAGG + Intergenic
1119614218 14:76087969-76087991 ACAGGTGTGAGCACTGTGCCCGG + Intergenic
1119694873 14:76705233-76705255 ACAGGTGTGAACACTGCGCCCGG + Intergenic
1120568353 14:86087113-86087135 TAAGGGGTGAACGCTTTGTCTGG + Intergenic
1122757336 14:103992575-103992597 CCAGGCGTGAGCACTGTGCCCGG - Intronic
1123899102 15:24858518-24858540 ACAGGTGTGACCACTGTGCCAGG - Intronic
1124377024 15:29134868-29134890 AAAGGTCTGAACCCTGTGCTAGG + Intronic
1125918934 15:43513050-43513072 ACAGGTGTGAGCACTGTGCCCGG - Intronic
1126898575 15:53286762-53286784 CAAGGTGTGATCCATGTACCTGG - Intergenic
1128214743 15:65926535-65926557 CAAGGAATGAGCGGTGTGCCAGG + Intronic
1128471545 15:67957784-67957806 CAGGGTGTCAACACTGTCCCAGG - Intergenic
1129755708 15:78097848-78097870 CAGGGTCTGAGCTCTGTGCCTGG - Intronic
1130294703 15:82637405-82637427 AAAGGTGTGAGAGCTGTGGCAGG - Intronic
1131146079 15:90013377-90013399 ACAGGTGTGACCACTGTGCCTGG + Intronic
1136026048 16:27469731-27469753 CAAGGGGTGAGCGCGGTGCACGG - Intronic
1142219496 16:88846817-88846839 ACAGGTGTGAGCACTGTGCCCGG + Intronic
1142309467 16:89303920-89303942 CAAGGCGTAGAGGCTGTGCCAGG - Intronic
1142982178 17:3678686-3678708 CAAGGAATGAAAGCTGGGCCAGG + Intronic
1143439268 17:6955851-6955873 CAAGGTGTGGAGGCGGTGCCAGG - Intronic
1147758265 17:42782117-42782139 CAAGGGGCGAGCCCTGTGCCAGG - Intronic
1148161346 17:45451876-45451898 CAAAGTGTGAGCGCTGGGGCAGG + Intronic
1152778126 17:82214515-82214537 ACAGGTGTGAGCACTGTGCCCGG - Intergenic
1164653634 19:29903740-29903762 ACAGGAGTGAACACTGTGCCTGG + Intergenic
1164736352 19:30544122-30544144 CCAGGTGGGCACGCTGTTCCAGG - Intronic
1165524113 19:36338265-36338287 ACAGGTGTGACCCCTGTGCCAGG + Exonic
925650596 2:6085466-6085488 CTAGGAGTGAACACTGGGCCTGG + Intergenic
925820124 2:7792057-7792079 CAAGGACTCAACGCTGTCCCTGG - Intergenic
931795125 2:65701092-65701114 CAAGGTGTGAGCTGTGGGCCTGG + Intergenic
941086416 2:161123379-161123401 CAAGCTGTGAAAGCAGTGGCAGG + Intergenic
946189189 2:217998774-217998796 ACAGGTGTGACCACTGTGCCTGG + Intronic
946634074 2:221705297-221705319 CAAGATGTCAACGCTCTGCATGG + Intergenic
947947442 2:234118469-234118491 CAATGTGTGAACTCTGGGGCTGG + Intergenic
948520923 2:238537163-238537185 CTAGGTGTGACCGCTGCACCAGG - Intergenic
948625285 2:239264774-239264796 CAGGGTGTAAACACTGTGCAGGG + Intronic
1171268905 20:23798327-23798349 CACGGTGTGAAAGGTGTGGCAGG - Intergenic
1172262254 20:33578050-33578072 GAAGGTGTGTACGGTGTTCCTGG + Intronic
1173992336 20:47313086-47313108 ACAGGTGTGAACACTGTGTCCGG - Intronic
1174192080 20:48747790-48747812 CAAGGTGTGGACGCTGGGGCTGG - Exonic
1174667748 20:52275853-52275875 CAAGAGGTGAACTCTGTGCTAGG - Intergenic
1175837922 20:62008239-62008261 CAAGGCGGGAAGGCGGTGCCTGG + Intronic
1178676929 21:34638970-34638992 CAAGATGTGAAGCCTCTGCCTGG - Intergenic
1182978618 22:34646948-34646970 CTGTGTGTGAATGCTGTGCCAGG - Intergenic
1185379005 22:50498284-50498306 ACAGGAGTGACCGCTGTGCCTGG + Intergenic
950477516 3:13223402-13223424 CCAGGGGTGGAGGCTGTGCCAGG - Intergenic
963363778 3:144308879-144308901 GAAAGTGAGAACCCTGTGCCAGG + Intergenic
965821339 3:172687282-172687304 CAAGGGGTGAAAACTGAGCCAGG - Intronic
966918942 3:184600072-184600094 CTATGTGTCAACACTGTGCCAGG - Intronic
966931964 3:184681161-184681183 CAGCGTGAGAGCGCTGTGCCAGG + Intronic
968026169 3:195443841-195443863 CAAGGTGAGTACGATGAGCCTGG - Intergenic
968504573 4:965909-965931 AAAGGTGTGACCACTGTGGCTGG - Exonic
968798317 4:2724570-2724592 CAAGGTGTGAACGCTGTGCCTGG - Intronic
969273781 4:6120921-6120943 ACAGGTGTGAGCACTGTGCCCGG - Intronic
971802105 4:31305736-31305758 CAGGGTGGGAACCCTGTGCACGG + Intergenic
972758190 4:42073140-42073162 CTAGGTGTGAGCACCGTGCCCGG + Intronic
972771911 4:42205130-42205152 CAAGGTGTTGGCCCTGTGCCTGG + Intergenic
973623904 4:52752052-52752074 TCAGGTGTGTACTCTGTGCCAGG + Intergenic
977435688 4:96991329-96991351 CAATGTTTGAAGGCTGTGGCAGG + Intergenic
978084695 4:104636288-104636310 CAAGGTGTGAACATTTTTCCTGG + Intergenic
978397624 4:108298807-108298829 CCAGGTGTGGTGGCTGTGCCCGG - Intergenic
982550055 4:156786544-156786566 CAAGGAGGGGACGCTGTGGCTGG + Intronic
985657786 5:1140934-1140956 CAAGGTGGGCAAGCTGGGCCTGG + Intergenic
985943305 5:3156064-3156086 CAATGTGAGACTGCTGTGCCTGG + Intergenic
986751019 5:10787973-10787995 CAAGCTGAGAACGCTGAGCCTGG + Intergenic
990145580 5:52756752-52756774 CAAGCTGTGAACTCTGGGCAGGG - Intergenic
991289800 5:65022638-65022660 AAAGGTTTGAACCCTTTGCCAGG + Intergenic
998872312 5:146564819-146564841 TAAGGGGTTAACTCTGTGCCAGG - Intergenic
1007315689 6:40986793-40986815 CAAGGTGGAAAGCCTGTGCCCGG - Intergenic
1008963272 6:57288448-57288470 CAAAGCTTGAACGCTGTGCCGGG - Intergenic
1010975876 6:82313122-82313144 CAAGGTCTGAGCCCTGTGCATGG + Intergenic
1013282283 6:108649664-108649686 ACAGGTGTGAGCCCTGTGCCTGG + Intronic
1013768394 6:113599242-113599264 CAAAGTGTGAACTCAGTTCCGGG - Intergenic
1015785731 6:136921138-136921160 AAAGGTGTGAACCCTGGCCCAGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016395126 6:143616308-143616330 AAAGGTATAAATGCTGTGCCAGG - Intronic
1016855963 6:148671102-148671124 CATAGTGTGAATGCTGTGCTGGG + Intergenic
1017882486 6:158571696-158571718 CAAAGTGTGAAGGCTGGCCCAGG - Intronic
1018956915 6:168416351-168416373 CAAGGTGTGAACAGGGTGTCTGG - Intergenic
1020694252 7:11394456-11394478 AAAGGTGCGAAGGCTCTGCCTGG + Intronic
1023070637 7:36429053-36429075 ACAGGTGTGAACACTGTGCCTGG + Intronic
1023815436 7:43946056-43946078 ACAGGTGTGACCACTGTGCCCGG + Intronic
1025230186 7:57198748-57198770 ACAGGTGTGACCACTGTGCCTGG - Intergenic
1028686623 7:93596947-93596969 CAAGGTATGCACTTTGTGCCTGG - Intronic
1029655820 7:101923796-101923818 CAAGGTGGGCATGCTGAGCCAGG - Intronic
1030309591 7:108055898-108055920 AGAGATGTGATCGCTGTGCCCGG - Exonic
1035447157 7:158950957-158950979 CCAGGTGTGAGCACCGTGCCTGG + Intronic
1035962947 8:4157763-4157785 CCAGCTGTGAACGCTGGACCAGG - Intronic
1047492979 8:125389521-125389543 CAAAGTGTGAAGGCTGAGTCCGG + Intergenic
1047780832 8:128109629-128109651 CAAAGTGTGGACGCGGTGCCTGG - Intergenic
1049167985 8:141138660-141138682 ACAGGTGTGAGCGCTGCGCCCGG + Intronic
1049196104 8:141316464-141316486 CAAGTTGTGAACTGTGTACCAGG - Intergenic
1049344450 8:142130913-142130935 CAAGGTGTGAAGGTCCTGCCAGG + Intergenic
1049836630 8:144739596-144739618 ACAGGTGTGACCACTGTGCCCGG + Intronic
1050102843 9:2136462-2136484 ACAGGCGTGAACACTGTGCCTGG + Intronic
1053198745 9:36138656-36138678 CAAGCTGTGGACCCAGTGCCGGG + Intronic
1061625303 9:131837766-131837788 CAAGATGTGCAGGCTGTTCCCGG - Intergenic
1185972317 X:4679063-4679085 ACAGGTGTGAGCCCTGTGCCCGG - Intergenic
1190866081 X:54385680-54385702 ACAGGTGTGAGCACTGTGCCTGG + Intergenic
1191225619 X:58040204-58040226 CTAGCTGAGAACCCTGTGCCTGG + Intergenic
1192140994 X:68647287-68647309 CAAGGTGTGAATGCAGTCCACGG - Intergenic
1194251585 X:91582191-91582213 CAAGGTCTTTATGCTGTGCCAGG + Intergenic
1198201936 X:134430470-134430492 CAATATGTGACCTCTGTGCCTGG - Intergenic
1200570522 Y:4823423-4823445 CAAGGTCTTTATGCTGTGCCAGG + Intergenic