ID: 968799391

View in Genome Browser
Species Human (GRCh38)
Location 4:2732274-2732296
Sequence CACCCTAGGCGGGCTGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968799378_968799391 21 Left 968799378 4:2732230-2732252 CCGGGGTATCGGCCGTCACTCAG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 203
968799380_968799391 -6 Left 968799380 4:2732257-2732279 CCTGTGCCCCTGCGTCTCACCCT 0: 1
1: 0
2: 1
3: 15
4: 351
Right 968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 203
968799377_968799391 26 Left 968799377 4:2732225-2732247 CCTCACCGGGGTATCGGCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 13
Right 968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 203
968799379_968799391 9 Left 968799379 4:2732242-2732264 CCGTCACTCAGCTCTCCTGTGCC 0: 1
1: 0
2: 6
3: 56
4: 416
Right 968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968799391 Original CRISPR CACCCTAGGCGGGCTGGGCG GGG Exonic
900184602 1:1327182-1327204 CACCCCAGGCGGGCTGCCCCAGG + Intronic
901056573 1:6451215-6451237 CACCCCAGCCGGGCTGAGCCAGG + Intronic
902338057 1:15765135-15765157 CACCCGAGGCTGGCTTGGCGGGG + Exonic
903190210 1:21652006-21652028 CGCCCTGGGCCGGCCGGGCGGGG + Intronic
903639423 1:24848363-24848385 CACCCTAGGTGGGGTGGGGTGGG + Intergenic
904732976 1:32608735-32608757 CAAGCTAGGCTGGCTGGGCACGG + Intronic
905365982 1:37451886-37451908 TACCCTAGGGCGGCCGGGCGCGG - Intergenic
905933652 1:41807020-41807042 AGCCGTAGGTGGGCTGGGCGGGG - Intronic
911010825 1:93279390-93279412 TACCCCAGACTGGCTGGGCGCGG + Intergenic
912382487 1:109254954-109254976 CACCAAAGGCAGGCTGGGTGTGG - Intronic
914005063 1:143725452-143725474 CATCCTAAGTAGGCTGGGCGAGG + Intergenic
914433051 1:147637000-147637022 CACCTTGGGCTGGCTGGGCCTGG - Intronic
914514335 1:148361506-148361528 CACCCTAGTCGGGATGGCAGAGG + Intergenic
914789909 1:150868609-150868631 CAGCCTGGGCAGGCCGGGCGCGG + Intronic
917456873 1:175193034-175193056 CACCCGAGGTGGGCTGGCCCAGG - Intergenic
1064077392 10:12280095-12280117 CGACATAGGCAGGCTGGGCGCGG + Intergenic
1067088575 10:43255273-43255295 CAGCCTAGGCGGGCAGGGCTGGG - Intronic
1067847841 10:49737529-49737551 GACCCTAGCAGGGCTGGTCGAGG - Intronic
1068087956 10:52398397-52398419 TGCCCTAAGTGGGCTGGGCGCGG + Intergenic
1069140033 10:64811079-64811101 CACCAAAGGCAGGCTGGGCTTGG - Intergenic
1070968798 10:80546815-80546837 TACCGTATGCTGGCTGGGCGCGG - Intronic
1071039051 10:81284884-81284906 AACCCTTAGCCGGCTGGGCGCGG + Intergenic
1072277871 10:93840355-93840377 CTCCCTAGATGGGCTGGGCGCGG + Intergenic
1075675651 10:124294023-124294045 CACCCTAAGGTGGCGGGGCGGGG - Intergenic
1075741124 10:124697200-124697222 CTTCCTAGGCGGGCTGTGCTGGG + Intronic
1076793387 10:132787849-132787871 GACCCTGGGCGGGCCGGGAGGGG + Intergenic
1076877228 10:133221863-133221885 AACCCTAGGTGGGCAGGGCTGGG + Intronic
1076877250 10:133221947-133221969 AACCCTAGGTGGGCCGGGCTGGG + Intronic
1076877261 10:133221989-133222011 AACCCTAGGTGGGCCGGGCGCGG + Intronic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077149182 11:1061217-1061239 CACCCTAGTGGGGCTGGACCTGG - Intergenic
1077402552 11:2366349-2366371 CACCCCAGGCGGGCAGAGCCAGG - Intergenic
1080026574 11:27621414-27621436 GACCCTAGGGAGGCTGGGCTAGG - Intergenic
1080677120 11:34438690-34438712 CACCCCGGGCCGGCGGGGCGAGG + Intergenic
1080885283 11:36362417-36362439 CACCCTTGGCGGGGTGGGGGTGG + Intronic
1086001779 11:81992532-81992554 TACCCTGAGAGGGCTGGGCGTGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089344803 11:117784362-117784384 CTCCCTTGGCAGGCAGGGCGAGG - Intronic
1090075453 11:123577771-123577793 CATTCTTGGTGGGCTGGGCGAGG + Intronic
1092263341 12:6963675-6963697 CAAGGTGGGCGGGCTGGGCGGGG + Intergenic
1092407838 12:8233400-8233422 CACAGGAGGCTGGCTGGGCGTGG - Intergenic
1093938969 12:25031950-25031972 CACACAAGGACGGCTGGGCGTGG - Intronic
1096073759 12:48789476-48789498 GACCCTCGGTGGGCGGGGCGGGG - Intergenic
1096495436 12:52037120-52037142 CTCCCCCGGCGGGCGGGGCGGGG - Intronic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1101021883 12:100561104-100561126 AACCCTGGCCTGGCTGGGCGCGG + Intronic
1101968843 12:109298651-109298673 AACCTTAGAAGGGCTGGGCGTGG - Intronic
1103085716 12:118060940-118060962 ACCCCGGGGCGGGCTGGGCGGGG - Intronic
1103474725 12:121210084-121210106 CAGGCCAGGCGGACTGGGCGGGG + Exonic
1103487661 12:121294221-121294243 CACCCTCCCCTGGCTGGGCGTGG - Intronic
1103775604 12:123364615-123364637 CACCCTCGGGGGGCCGTGCGGGG - Intronic
1105000576 12:132687611-132687633 CACCTCAGGCTGGCCGGGCGCGG - Exonic
1107445336 13:40465609-40465631 CAACCAGGGCAGGCTGGGCGCGG - Intergenic
1108417007 13:50208346-50208368 CACCATATCCAGGCTGGGCGCGG - Intronic
1113085176 13:106562699-106562721 AACACTAGTCAGGCTGGGCGCGG + Intronic
1114262947 14:21051908-21051930 TACCCCAGGAGGGCTGAGCGAGG - Intronic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1119234652 14:73009464-73009486 CTCCTTAGGGAGGCTGGGCGCGG + Intronic
1119296499 14:73537586-73537608 CACCCTTGGCGAGCTGGACCTGG + Exonic
1119480242 14:74954277-74954299 CAGCCAAGGCGGGCTGTGCAGGG - Intronic
1122115831 14:99526801-99526823 CACCCTCAGCTGGCTGGGCTGGG + Intronic
1122267001 14:100551226-100551248 CACCCTAGCAGGGCCGGGCCGGG - Intronic
1122783523 14:104153645-104153667 CATCCTGGGAGGGGTGGGCGGGG + Intronic
1122871236 14:104640026-104640048 CACCTGCAGCGGGCTGGGCGGGG - Intergenic
1123037926 14:105478864-105478886 CAGCAGAGGTGGGCTGGGCGCGG + Exonic
1124632914 15:31347465-31347487 CACCCTCAGGGGGCTGGGCTGGG + Intronic
1131120137 15:89817203-89817225 TAGCCTAAGTGGGCTGGGCGTGG + Intergenic
1131825956 15:96322687-96322709 CCCCCTCGGCGAGCTCGGCGCGG - Intergenic
1131909931 15:97187235-97187257 AACCCTAAATGGGCTGGGCGCGG - Intergenic
1132687643 16:1168941-1168963 CACCCCAGGCGGGCAGGGGGCGG - Intronic
1133212467 16:4271322-4271344 CGCCCGAGGCAGTCTGGGCGGGG - Intronic
1134077134 16:11299886-11299908 CAGCCTAGGAAGGCTGGGCCAGG + Intronic
1135959298 16:26982475-26982497 CTCCCTAGGTAGGCTGGGTGTGG - Intergenic
1136184611 16:28579638-28579660 CTCCCCATGCTGGCTGGGCGTGG + Intronic
1136538461 16:30914271-30914293 CACCTTGAGGGGGCTGGGCGTGG - Intergenic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1141614893 16:85204820-85204842 CACCCTTGGCTGGCTGGGTGTGG - Intergenic
1141644157 16:85358470-85358492 CACCAGGGGCGGGCTGGGCTGGG - Intronic
1141858442 16:86700787-86700809 CACTCAAGGAGGGCTGGACGGGG - Intergenic
1142230813 16:88899498-88899520 ACCCCAAGGCGGGCTGGGAGTGG + Intronic
1142855015 17:2724429-2724451 CGCGCTGGGCTGGCTGGGCGCGG + Intergenic
1142912286 17:3104575-3104597 TACCCTAGGAAGGCTGGGTGTGG + Intergenic
1143390451 17:6556513-6556535 CAGCCGAGGCGAGCGGGGCGGGG - Intergenic
1143400772 17:6640627-6640649 CACCCTAGGCCAGGTGGGCTCGG - Exonic
1143560754 17:7693029-7693051 GACCCAAGAGGGGCTGGGCGCGG - Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1143630085 17:8133897-8133919 CACCCAAGGCAAGCTGAGCGGGG - Intergenic
1143639822 17:8189618-8189640 CAGCCTGGACGGGCTGAGCGAGG - Exonic
1146873230 17:36388752-36388774 CACCCTGGGCGGGGAGGGCTGGG - Intronic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1151558876 17:74860520-74860542 CTGCCTACGCGGGCAGGGCGGGG - Intronic
1152642012 17:81453151-81453173 CACTCCAGGGGGGCCGGGCGGGG - Intronic
1152824995 17:82458958-82458980 CACCCTGGGCCCGCTCGGCGTGG + Intronic
1153226698 18:2905912-2905934 CTCCCTAAGCGGGCCGGGCGCGG - Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1160786924 19:904541-904563 CACTCGAGGCAAGCTGGGCGCGG + Intronic
1161112175 19:2476641-2476663 CCCCCTTCCCGGGCTGGGCGCGG + Intronic
1161722919 19:5913700-5913722 TGCCCCAGGTGGGCTGGGCGCGG - Intronic
1163118128 19:15200346-15200368 CACCCCGGGCGGGCTGGGCCAGG - Intronic
1165324195 19:35104661-35104683 CACCCTCTGTGGCCTGGGCGGGG + Intergenic
1165700322 19:37932530-37932552 CACCCACAGCGGGCTGGGGGCGG + Intronic
1166253093 19:41584832-41584854 CAGCCTGGACGGGCTGGGTGGGG + Intronic
1167148803 19:47697272-47697294 CACTCATGGTGGGCTGGGCGTGG - Intronic
1168292598 19:55363836-55363858 GACTCCAGGCTGGCTGGGCGCGG - Intergenic
1168536405 19:57174029-57174051 CACCTGAGGTGGGCCGGGCGCGG - Intergenic
1168536442 19:57174173-57174195 CACCTGAGGTGGGCCGGGCGCGG - Intergenic
1168697483 19:58412497-58412519 CACCCTGGCCAGGCCGGGCGTGG - Intronic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927520725 2:23696466-23696488 CACCCTCGGGGGACTTGGCGTGG + Exonic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
931352058 2:61500288-61500310 CAGCCTGGCCAGGCTGGGCGTGG + Intronic
932231467 2:70087469-70087491 CAGCCTCGGCGGTCTGGGCGGGG - Exonic
939313235 2:140511589-140511611 ACCCCTAGAGGGGCTGGGCGCGG - Intronic
943872056 2:193012111-193012133 CAGCCTGGGAGGGCTGGGCCAGG - Intergenic
944001237 2:194841036-194841058 CACACTAGGGCTGCTGGGCGTGG + Intergenic
946621948 2:221571554-221571576 CACCCTCGGGGCGCTGGGCTTGG + Intronic
949060913 2:241956794-241956816 CACCCAGGGCTGGCTGGGCAAGG + Intergenic
1175466246 20:59192628-59192650 CAGCCCAGGCGGGCTGGGCCGGG - Exonic
1175902015 20:62363704-62363726 CCCCCAAGGGAGGCTGGGCGGGG - Intronic
1176243793 20:64087835-64087857 CACCCTTGGCAGGTTGGGGGAGG + Intronic
1179457306 21:41508243-41508265 CACCCTGGGCGGGCGGGGGCGGG + Intronic
1179457426 21:41508643-41508665 CAGCCTAGGCGGACTGGGGAGGG - Intronic
1179971419 21:44838199-44838221 GAGCCTAGGAGGGGTGGGCGGGG - Intergenic
1180026459 21:45165083-45165105 AACTCTAGGGTGGCTGGGCGGGG - Intronic
1180670363 22:17548381-17548403 CACCCTTGGGCGGCTGGGCCGGG - Exonic
1181052542 22:20244575-20244597 CTCCCTGGGTGGGCTGGGTGAGG + Intronic
1181514308 22:23402501-23402523 AACGCTAGGCGTGCAGGGCGAGG + Intergenic
1182518084 22:30870240-30870262 CACCCTGGGAAGGCTGGGCCAGG + Intronic
1183068619 22:35380966-35380988 GGCCCGGGGCGGGCTGGGCGCGG + Exonic
1183311029 22:37109582-37109604 CAGCCTGGGCTGGCTGGGTGGGG - Intergenic
1183403803 22:37620086-37620108 TACCCCAGGCTGGTTGGGCGGGG + Intronic
1183457097 22:37928831-37928853 AACCCTATCCTGGCTGGGCGTGG + Intronic
1183714192 22:39524154-39524176 CCTCCTAGGTGAGCTGGGCGTGG - Intergenic
1183786711 22:40033373-40033395 AACCTTAGCCAGGCTGGGCGTGG - Exonic
1183836527 22:40458785-40458807 CACCTCAGGCTGGCCGGGCGTGG + Intronic
1184276550 22:43412163-43412185 GACCGGAGGCGGGCGGGGCGCGG + Intronic
1184649527 22:45913218-45913240 CCCCCAAGGCGGGCAGGGGGAGG + Intergenic
1184663364 22:45975731-45975753 CACAGTAGGCGCGCAGGGCGCGG + Intronic
1184710220 22:46245316-46245338 CACACTTGGGGGGCTGGGCTGGG + Intronic
1185285140 22:49996729-49996751 CTCCCACGGCAGGCTGGGCGTGG - Exonic
951205676 3:19923663-19923685 AACATTAGGCAGGCTGGGCGTGG - Intronic
953563633 3:44013364-44013386 CACTCCAGGCTGGCTGGGCCGGG + Intergenic
953912884 3:46901710-46901732 CACCCTAGTGGGGCGGGGCAAGG - Intronic
955110334 3:55942585-55942607 GACCTTAGACGGGCCGGGCGCGG - Intronic
958774227 3:98462128-98462150 CACCATAAGTGGGCTGGGCGTGG + Intergenic
958977291 3:100682425-100682447 CGCCGTCGGCGGGTTGGGCGCGG - Intronic
962263162 3:133927662-133927684 TCCCGTGGGCGGGCTGGGCGTGG + Intergenic
964426029 3:156554899-156554921 CCGGCTAGTCGGGCTGGGCGGGG - Intronic
967983224 3:195077872-195077894 AACCCCAGGCAGGCTGGGCACGG - Intronic
968421751 4:490796-490818 AACCCTGTGCAGGCTGGGCGCGG + Intronic
968643037 4:1724260-1724282 CAGCCAAGGCCGGCCGGGCGTGG - Intronic
968698113 4:2042447-2042469 CACTCCCGGCGGGCTCGGCGCGG - Exonic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
969388096 4:6870008-6870030 CACCCTGGGCGAGCTGGGGCAGG + Intronic
969818036 4:9700349-9700371 CACAGGAGGCTGGCTGGGCGCGG + Intergenic
971245005 4:24919497-24919519 CAACCTTGGCGGGCAGGGGGTGG + Intronic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
974894497 4:67922847-67922869 CACCCAAGGCGGCCTGGCCTTGG - Exonic
980130801 4:128813709-128813731 GACCGTAAGCAGGCTGGGCGTGG - Intronic
980698779 4:136395592-136395614 AACCCTCGGCGGGCGGGGCGGGG - Intergenic
982337572 4:154257541-154257563 CACCTTTGGCGGGATGGGAGTGG + Intronic
986404955 5:7416355-7416377 GCCCCTTGGAGGGCTGGGCGCGG + Intronic
987834724 5:23146336-23146358 CACACTAAGCTCGCTGGGCGGGG - Intergenic
998200322 5:140113710-140113732 GACCCTAGGCGGCCTCGGCCTGG - Intronic
999311081 5:150552652-150552674 AACCCAAGGCGGGCAGGGCCAGG - Intronic
1001401909 5:171450998-171451020 GACCCCAGGAGGGCTGCGCGGGG + Intronic
1002196893 5:177506026-177506048 CCCGGGAGGCGGGCTGGGCGCGG - Intronic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002888628 6:1316470-1316492 CACACTGGGCGGGCGGGGCGGGG + Intergenic
1004500174 6:16202150-16202172 AACCCTAAGGGGGCCGGGCGAGG + Intergenic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1008013542 6:46491991-46492013 CACCCTCAGCGGCCTGGGCTGGG - Intergenic
1013509141 6:110828879-110828901 AGCCCTATGCTGGCTGGGCGCGG + Intronic
1018046184 6:159968860-159968882 GCCTCTCGGCGGGCTGGGCGCGG - Intergenic
1019504025 7:1381698-1381720 CACCCTTGGGGGGCTGGGAGGGG - Intergenic
1019793889 7:3035589-3035611 AATCCAAGGAGGGCTGGGCGCGG - Intronic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1020303215 7:6812196-6812218 CAGAATAGGCCGGCTGGGCGTGG + Intronic
1022507787 7:30917307-30917329 GACCCAAGGAGGGTTGGGCGGGG + Intronic
1024725374 7:52188926-52188948 GACACTAGCCGGGGTGGGCGTGG + Intergenic
1025209031 7:57010192-57010214 TACACTTGGCGGGGTGGGCGGGG - Intergenic
1025662919 7:63566664-63566686 TACACTTGGCGGGGTGGGCGGGG + Intergenic
1029134620 7:98360331-98360353 AACACAAGGCAGGCTGGGCGTGG - Intronic
1029477358 7:100792819-100792841 GACCCTGGATGGGCTGGGCGTGG + Intronic
1029589155 7:101495707-101495729 TACCCTACGCTGGCCGGGCGCGG - Intronic
1030682164 7:112445354-112445376 AAGCCTAGGCCGGCCGGGCGGGG - Intronic
1032277829 7:130475261-130475283 AAACCAAGGAGGGCTGGGCGCGG - Intergenic
1033656823 7:143380820-143380842 CACCCCAGGCGGACTCGGGGTGG + Intergenic
1034595944 7:152192250-152192272 CAGCATATGGGGGCTGGGCGCGG + Intronic
1034941708 7:155234841-155234863 AACCCTTGGATGGCTGGGCGCGG - Intergenic
1035187521 7:157138505-157138527 CACCCGGAGCGGGCTGGGAGCGG - Intergenic
1035745350 8:1958686-1958708 CAACCTCGGGGGGCTGGGTGGGG + Intergenic
1036177953 8:6557023-6557045 CCACCTAGGAGGGGTGGGCGGGG + Intronic
1036733286 8:11284732-11284754 CGCCCCAGGCTGGGTGGGCGCGG - Exonic
1037142337 8:15534351-15534373 AACTTTAGCCGGGCTGGGCGCGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037883644 8:22585265-22585287 CTCCCTGGGCAGGCTGGGGGTGG + Intronic
1038023787 8:23571552-23571574 CATCTCAGGCGGGCTGGCCGGGG + Exonic
1038425624 8:27462192-27462214 GACCCCAGGCAGGCTGGGGGTGG + Intronic
1039560846 8:38511223-38511245 CAGCCCAGGCCGGCTGGGCATGG - Exonic
1039584984 8:38699436-38699458 CTCCCTAGGCTGACTGGGCGCGG - Intergenic
1043610743 8:82059918-82059940 CATCATAGACGGGCTGGGTGCGG - Intergenic
1047214056 8:122862750-122862772 CTTTCAAGGCGGGCTGGGCGTGG + Intronic
1049426704 8:142541038-142541060 CACCCAGGGCTGGCTTGGCGTGG + Intronic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1056641034 9:88370800-88370822 CAAAATAGGCGGGCTGGGTGCGG + Intergenic
1056642649 9:88384435-88384457 AAACCTTGGCCGGCTGGGCGCGG - Intergenic
1059268864 9:113060301-113060323 CCACCTGGGCGGGCTGGACGTGG - Intergenic
1059270000 9:113065750-113065772 CCACCTGGGCGGGCTGGACGTGG - Intergenic
1059271134 9:113071198-113071220 CCACCTGGGCGGGCTGGACGTGG - Intergenic
1059272267 9:113076644-113076666 CCACCTGGGCGGGCTGGACGTGG - Intergenic
1059273402 9:113082086-113082108 CCACCTGGGCGGGCTGGACGTGG - Intergenic
1059274538 9:113087532-113087554 CCACCTGGGCGGGCTGGACGTGG - Intergenic
1060324928 9:122605039-122605061 CTCCCCAGACGGGCTGGGCACGG + Intergenic
1061226429 9:129283482-129283504 CCCCCTAGACCGGCTGGGCATGG - Intergenic
1061866445 9:133493970-133493992 CACCCTCGGCAGGCTGGGGCAGG + Intergenic
1062127227 9:134870296-134870318 CACACTAGGCCGGGTGGGCCAGG - Intergenic
1062129722 9:134885878-134885900 TACCCTGGGCGGTCAGGGCGTGG - Exonic
1062350384 9:136135835-136135857 CACAGCAGGCGGGCTGGGCAGGG - Intergenic
1062574671 9:137200606-137200628 CAAGCTAGCCGCGCTGGGCGGGG - Exonic
1062587311 9:137255193-137255215 CGCGCTGGGCTGGCTGGGCGGGG + Exonic
1186979055 X:14939598-14939620 CCCCCAAGGTGGGCTGGGCATGG - Intergenic
1190533959 X:51407839-51407861 CAGCCTCGGCGGGCAGGGCCTGG - Exonic
1201892887 Y:18962069-18962091 AAACCTAGGCAGGCTGGGTGTGG + Intergenic