ID: 968801471

View in Genome Browser
Species Human (GRCh38)
Location 4:2745974-2745996
Sequence GCAGCTGGGGGCCCCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968801471_968801485 18 Left 968801471 4:2745974-2745996 CCAGTGAGGGGGCCCCCAGCTGC 0: 1
1: 0
2: 2
3: 20
4: 258
Right 968801485 4:2746015-2746037 TGCACCCTGCTTACCTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 174
968801471_968801480 -8 Left 968801471 4:2745974-2745996 CCAGTGAGGGGGCCCCCAGCTGC 0: 1
1: 0
2: 2
3: 20
4: 258
Right 968801480 4:2745989-2746011 CCAGCTGCCCAGGGTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968801471 Original CRISPR GCAGCTGGGGGCCCCCTCAC TGG (reversed) Intronic
900546637 1:3233164-3233186 GCTGCTGGAGGCTCCCTCACTGG - Intronic
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
900777245 1:4594400-4594422 CCAGCTGGGGGCTGCCTCAGGGG - Intergenic
901179602 1:7332151-7332173 GCAGATCGGGGCCCCCTCAGAGG - Intronic
901532808 1:9864095-9864117 GCAGCTGGGGGAACCTTCCCTGG + Intronic
903179486 1:21598077-21598099 GCAGGAGGGAGCCACCTCACTGG + Intronic
903287625 1:22286628-22286650 CCAACTGAGGGCCCCCTCACTGG - Intergenic
905344548 1:37302496-37302518 GAAGCTGGGAGCCCCCCCTCGGG + Intergenic
905515406 1:38558667-38558689 ACAGCTGGGGGCGCCTTCGCAGG + Intergenic
905667086 1:39769698-39769720 GCAGCAGGTGGCACCCTGACGGG - Exonic
905670818 1:39788958-39788980 GCAGCCCCGGGCCCCCTCGCAGG - Intergenic
906156498 1:43617111-43617133 ACAGGTGGTGGCCCCCTCTCAGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
915142487 1:153776097-153776119 GCAGCAGGGGGCCCCGGCGCAGG - Exonic
919165377 1:193885316-193885338 GCAGCTGTGGCCACCCTCCCAGG - Intergenic
920093459 1:203470589-203470611 GCTGCTGGGTGGCCCCCCACGGG + Intergenic
922604660 1:226882062-226882084 GCAGCTGGGGGCCTTCAAACAGG + Intronic
922729278 1:227941583-227941605 GCAGCTGGGGCCGACCTCAAGGG + Intronic
923272397 1:232369590-232369612 GCAGCAGGGAGCCTCCTCTCTGG - Intergenic
923835199 1:237603414-237603436 GCCCCTTGGGGCCACCTCACGGG - Intronic
1065195994 10:23266128-23266150 GCAGCTGGAGCCCCCCACTCAGG + Intergenic
1070672659 10:78388839-78388861 CTAGCTCGGGGCCCCCCCACTGG - Intergenic
1071579420 10:86756366-86756388 GCAGCTCGGCGCCCCCTTGCCGG + Intergenic
1072674659 10:97456833-97456855 TGAGCTGGGAGCCCCCTCCCTGG + Exonic
1072728282 10:97828133-97828155 GCAGCTGGGGCCCTGCTCCCAGG - Intergenic
1075715983 10:124555532-124555554 ACAGCTGGGGGACCCTTCCCAGG - Intronic
1076243538 10:128928340-128928362 GGGGCCGGGGGCCCCATCACCGG + Intergenic
1077231859 11:1461308-1461330 GCACCTGGAGGCCTCCTCGCAGG + Exonic
1077431516 11:2518153-2518175 GCAGCTGGTGGGCCCCTGCCTGG + Intronic
1077548486 11:3188265-3188287 CCAGCTTGGGCCCCTCTCACAGG + Intergenic
1078066521 11:8082381-8082403 GTCTCTGGGGGGCCCCTCACAGG + Intronic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1078730064 11:13965410-13965432 GCAGCTGGTGGCCCTAGCACTGG + Intronic
1084494657 11:69496994-69497016 GGAGCTGGGGAACCACTCACAGG + Intergenic
1085479583 11:76810181-76810203 TCAGCTGGAGCCCCCGTCACAGG + Intergenic
1085607485 11:77915309-77915331 GCTACTGGGGGGCCCATCACTGG + Intronic
1089215158 11:116830533-116830555 GGACCTGGGGTGCCCCTCACAGG + Intronic
1089566909 11:119376440-119376462 GCAGCAGGGGCCCCCCGCACTGG - Intronic
1089653924 11:119933397-119933419 CCAGCTGGTGGCACCCTCTCTGG + Intergenic
1091231005 11:133988116-133988138 GCTGCTTAGGGCCCCCTCCCTGG - Intergenic
1091330237 11:134726157-134726179 CCAGCAGGGGGCCCCTTCTCAGG - Intergenic
1092262858 12:6961801-6961823 GCAGCTGGGGCCACCCTCAGGGG + Intergenic
1092544020 12:9437563-9437585 TCAGCTCGGCGCCTCCTCACTGG + Intergenic
1096238482 12:49945726-49945748 CCAGCAGGGGGCGTCCTCACCGG + Intergenic
1101558806 12:105836089-105836111 GCAGATGAGGGTCACCTCACAGG - Intergenic
1102534432 12:113570066-113570088 GCAGCTGGGCCCCCACTCAGGGG + Intergenic
1102634022 12:114307034-114307056 GCAGCTGGGGGCCTCATCAGTGG - Intergenic
1103817762 12:123672162-123672184 CTAGCTGGGGGCCTCTTCACAGG - Intronic
1103883000 12:124180793-124180815 GCAGATGGGGGCCTTCTCACAGG - Intronic
1103980673 12:124734980-124735002 GCAGCTGCCGGCCACCTCCCAGG - Intergenic
1106946538 13:34833699-34833721 CCTGCTGGGGGCAGCCTCACAGG + Intergenic
1107419327 13:40232151-40232173 GCAGCTGGTGGCCACCGCACGGG + Intergenic
1107604099 13:42041023-42041045 GCAGCTGGGGACCTCATCCCGGG - Intronic
1113358883 13:109610145-109610167 GAAGCTGGTGGCCCCCACACTGG + Intergenic
1113440342 13:110323518-110323540 GAAGCTGGGGGCCAGCCCACAGG + Intronic
1113901332 13:113799990-113800012 GGAGCTGGAGGCCCTCTCAGTGG + Intronic
1113932766 13:113976911-113976933 GCAGGTGGGGGCATCCTCCCCGG - Intergenic
1114228901 14:20762791-20762813 GCAACTGGGGGCACCCTTACCGG + Intergenic
1114476444 14:22998522-22998544 GCAGCTGGGAGCAGCCTCAGTGG - Exonic
1116130781 14:40854267-40854289 GCAGCTGTGGGTGCCCTCCCAGG + Intergenic
1120788149 14:88555121-88555143 GCAGCGGCGCGCCCCCTCCCCGG - Intergenic
1121955692 14:98210552-98210574 GCAGCCCGGGCCCCCCGCACAGG + Intergenic
1125200069 15:37095406-37095428 GCAGCTTAGAGCCCCCGCACGGG - Intronic
1125451032 15:39807895-39807917 GCAGCTAGTGGCCACCACACTGG + Intronic
1126100950 15:45117903-45117925 CCAGATTGGGTCCCCCTCACAGG - Exonic
1127525972 15:59792242-59792264 GCAGCTGGGGGCCGGCTTGCAGG - Intergenic
1127638142 15:60890560-60890582 CCTGCTCGGGGCCCCTTCACAGG + Intronic
1127656451 15:61060588-61060610 GAAACTGTGGACCCCCTCACTGG + Intronic
1128790781 15:70432047-70432069 GCAGCTGCGGCCACCCTCCCAGG - Intergenic
1132456931 16:29232-29254 GCTGCTAGGGGCCCCTTCTCAGG + Intergenic
1132653353 16:1031361-1031383 GAAGCTGGGGGGCCCCTGATGGG + Intergenic
1132685371 16:1159855-1159877 CCAGCTGCGGGCACCCTCCCTGG + Intronic
1132685968 16:1162270-1162292 GCAGGTGGGGGCACCCTGGCAGG - Intronic
1133131419 16:3678355-3678377 GCAGCTGGTGGCCGCTACACAGG + Intronic
1133220612 16:4317673-4317695 GCACCTGGGAGGCCCCTCCCAGG + Intronic
1136174637 16:28508256-28508278 GCAGCTGGGGCTCCCCACAGCGG + Intronic
1136366156 16:29810157-29810179 ACAGCTGTGGGCTCCCTCTCGGG + Exonic
1136711478 16:32240552-32240574 GCAGCTGTGTGCCCCCTGCCAGG + Intergenic
1136756432 16:32688853-32688875 GCAGCTGTGTGCCCCCTGCCAGG - Intergenic
1136811679 16:33181520-33181542 GCAGCTGTGTGCCCCCTGCCAGG + Intergenic
1136818155 16:33291600-33291622 GCAGCTGTGTGCCCCCTGCCAGG + Intronic
1136824719 16:33348129-33348151 GCAGCTGTGTGCCCCCTGCCAGG + Intergenic
1136829785 16:33446900-33446922 GCAGCTGTGTGCCCCCTGCCAGG + Intergenic
1137291601 16:47055456-47055478 GCAGCTGCGGCCACCCTCCCAGG - Intergenic
1138473119 16:57254345-57254367 GCAGGTGGGAGCCCCATCAAAGG - Intronic
1141714590 16:85719488-85719510 GAAGATGGGGGCTGCCTCACTGG - Intronic
1141724748 16:85780359-85780381 GCAGCATGGGGCGCACTCACTGG + Exonic
1141811232 16:86377801-86377823 GCAGCTGGGGGCCCTCTGGGCGG - Intergenic
1142185619 16:88693500-88693522 GCAGCTGGGAGGCCCCTTATTGG + Intergenic
1142257912 16:89024165-89024187 GCAGCTGGTTGCCCACCCACAGG + Intergenic
1202990257 16_KI270728v1_random:4489-4511 GCAGCTGTGTGCCCCCTGCCAGG + Intergenic
1203058576 16_KI270728v1_random:949207-949229 GCAGCTGTGTGCCCCCTGCCAGG - Intergenic
1142585518 17:970393-970415 GGAGTTGGGGGGCCCTTCACTGG + Intronic
1143515248 17:7416303-7416325 GGAGTTGGGGGCCCACTCAGTGG + Intronic
1143524274 17:7463222-7463244 GGAGGTGGGGGTCCCCCCACAGG - Exonic
1143681888 17:8481900-8481922 GCAGGTGGGGGCCTCCGCAGGGG + Intronic
1143867045 17:9931541-9931563 GCTGCTGGGGGCCCCGACAGGGG + Intronic
1144743787 17:17599680-17599702 GCTGGTGGGGGCCACCACACCGG + Intergenic
1144743972 17:17600788-17600810 GCTGGTGGGGGCCACCACACCGG - Intergenic
1145272438 17:21411976-21411998 GGTGCTGGGAGCCCCCTCACTGG - Intronic
1145310646 17:21699441-21699463 GGTGCTGGGAGCCCCCTCACTGG - Intronic
1147120757 17:38333891-38333913 GGGGCTGGGGTCCACCTCACAGG + Intronic
1147758093 17:42781319-42781341 GCGGCTGGGAGCCCCCTCGGTGG + Intronic
1147951602 17:44110881-44110903 GCCTCTGGCGGCCCCCTCCCTGG - Intronic
1149034682 17:52120634-52120656 GCAGCTGGGGGAACCTGCACAGG + Intronic
1149422042 17:56520628-56520650 CCAGCTGAGGGCTTCCTCACGGG + Intergenic
1151824121 17:76514119-76514141 CCAGCTGGGAGCCCCATGACAGG - Intergenic
1151975600 17:77482144-77482166 GCAGCTGGGAGCCGCCTCAGTGG - Exonic
1152227368 17:79098656-79098678 GCAGCTGGTGTCCCCCGCAGAGG - Intronic
1152534106 17:80940665-80940687 GCCGCGGGGGGCCTGCTCACAGG - Intronic
1160501966 18:79406072-79406094 GCAGCTCTGGGCTCCGTCACTGG + Intronic
1160780717 19:876868-876890 GCAGGTGGGGGCCCCGTGGCAGG - Intronic
1160780734 19:876903-876925 GCAGGTGGGGGCCCCGTGGCAGG - Intronic
1160863902 19:1249020-1249042 GCAGCGCGGCGCCCCCTCCCCGG + Intronic
1160928226 19:1557005-1557027 GGAGGTAGGGGCTCCCTCACTGG - Intronic
1161129876 19:2581479-2581501 GGATGTGGGGGCCCCCTCCCTGG + Intronic
1161199240 19:3005460-3005482 GCAGCTGGCGGCCCTCCCGCAGG + Exonic
1161403251 19:4078200-4078222 GCAGGTGGTGGACCCCTCCCCGG - Intergenic
1161493339 19:4574806-4574828 TTACCTGGGGGCCCCCTCCCCGG - Intergenic
1163653316 19:18531632-18531654 GGAGCTGGGGGTCTCCTCTCCGG - Intergenic
1163683285 19:18696080-18696102 GCAGCTGGTGGCGTCCTCCCGGG + Intronic
1164624159 19:29715372-29715394 GCTGCTGGGCACCCCCTCCCCGG + Intronic
1165328309 19:35126689-35126711 ACAGCTGTGAGCCCCCCCACAGG + Exonic
1167504507 19:49863963-49863985 GAAGCTGGGGGTCCCCTTCCAGG - Exonic
1168316094 19:55485388-55485410 GCAGCACGGGGCTCCCTCCCAGG - Intronic
925270113 2:2599656-2599678 GCTTCTGGGGGCACCATCACGGG - Intergenic
925553047 2:5096740-5096762 GCAGGAGGGGGCCCCCTCCGAGG - Intergenic
926112580 2:10192590-10192612 GCGGCTGGGCACCCCCTCGCTGG + Intronic
926134921 2:10329774-10329796 GCAGCTGGGAGCCCCAACCCAGG - Intronic
926886463 2:17603290-17603312 TCTGCTGAGGGCCCCCTCTCTGG + Intronic
927967488 2:27280437-27280459 GCAGCAGAAGGCACCCTCACTGG - Exonic
928082299 2:28322205-28322227 GCAGCTGGAAGCTCCATCACTGG - Intronic
928698953 2:33879710-33879732 GCAGCTGTGTGCCCCTTCTCAGG + Intergenic
932447248 2:71788412-71788434 GGGGCTGGCGGCCCCCTCCCTGG + Intergenic
934809326 2:97266982-97267004 CCAGTTGGGAGGCCCCTCACTGG - Intergenic
934828124 2:97489970-97489992 CCAGTTGGGAGGCCCCTCACTGG + Intergenic
936520990 2:113212132-113212154 ACAGCTGGGGGCCTCCCCACTGG + Intergenic
937238919 2:120447693-120447715 GCAGCTGGGGTCACACTCAGGGG + Intergenic
937616475 2:123928611-123928633 GCAGCTGGGTGCCAGCTGACAGG + Intergenic
938194987 2:129319218-129319240 GCAGCTGCGGTCGCCCTCCCAGG - Intergenic
938765817 2:134459980-134460002 GCAGCTGGTGGCCCCATCTACGG - Intronic
943797302 2:192012535-192012557 TTAGCTAGGGGCCCCTTCACAGG + Intronic
948293632 2:236845458-236845480 GCAGCTGTGGCCACCCTCCCAGG - Intergenic
948455267 2:238101818-238101840 GGAGCTGGAAGCCCCTTCACTGG + Intronic
1169445738 20:5669624-5669646 GCAGCTGGAGGCCCCCATAGAGG - Intergenic
1170756665 20:19212042-19212064 GGCGCAGGGGGCCCCCTCTCGGG - Intergenic
1171457190 20:25278751-25278773 GGGGCTGGGGGCTCTCTCACTGG - Intronic
1172117367 20:32581074-32581096 CCAGCTGGGGGCCTCCTGGCCGG - Intronic
1172519144 20:35556137-35556159 GCGGCTGGGGGCTGCCTCCCGGG - Intronic
1172954861 20:38748832-38748854 GCACCTGGGTGTCTCCTCACAGG + Exonic
1174358577 20:50014355-50014377 TCAGATGGGGGCTCCCTCAGGGG + Intergenic
1174436270 20:50509537-50509559 GCAGCTGGGCCCCACCACACCGG + Intergenic
1175573979 20:60046630-60046652 GCAGCTTGGGGCTCCCACAATGG + Intergenic
1176019836 20:62956990-62957012 GCTGGTGGGGGCCGCCCCACTGG + Intronic
1176159103 20:63639644-63639666 GCAGCTGCGGGCTCCCTGTCTGG - Intergenic
1176231708 20:64036331-64036353 GCAGCTGTGGGCCTCCTCTAGGG + Intronic
1176292518 21:5053806-5053828 GCAGCTGGGGGAGCCCTCCTTGG - Intergenic
1176548741 21:8212773-8212795 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1176556636 21:8256982-8257004 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1176567672 21:8395808-8395830 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1176575575 21:8440024-8440046 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1178086905 21:29121273-29121295 GCAGCTGGTGGCCAACTCATGGG + Intronic
1179864740 21:44209844-44209866 GCAGCTGGGGGAGCCCTCCTTGG + Intergenic
1181671576 22:24427828-24427850 GGAGCTGGGGCCCCCAGCACTGG + Intronic
1181871626 22:25903696-25903718 GCTGCTGGGGTCACCCTCTCTGG + Exonic
1182724959 22:32437530-32437552 GCAGCTGTGTGCCACCACACTGG + Intronic
1183063454 22:35348963-35348985 GCAGCTGGGGGCAGGCACACTGG + Intergenic
1183406490 22:37632933-37632955 GCCGCTGGGGTCTCCATCACCGG + Exonic
1183573997 22:38675390-38675412 GGAGCTGGGGGCGGCCTCAAAGG + Intergenic
1183702548 22:39458117-39458139 GGAGCCGGGGGCCCCCACCCCGG - Intronic
1183805773 22:40209604-40209626 GCAGCAGGGGATCCTCTCACTGG - Intronic
1183858454 22:40652419-40652441 GCAGCTGTGTGCCCCATCCCGGG - Intergenic
1184093005 22:42302127-42302149 AGAGCTGAGGGGCCCCTCACTGG + Intronic
1184797105 22:46738688-46738710 CCAGCTGCAGGCCCCCTCCCAGG - Intergenic
1185118423 22:48951262-48951284 CCAGCTGGGGTCCCATTCACAGG - Intergenic
1185180565 22:49358437-49358459 GCTGCTGGGGGGCCCCTTTCTGG - Intergenic
1203253624 22_KI270733v1_random:129078-129100 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1203261680 22_KI270733v1_random:174157-174179 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG + Intronic
953410696 3:42688990-42689012 GCAGCTGGGGTCACCGACACAGG + Exonic
953844019 3:46412632-46412654 GCTGCTGGGGGTGCCCCCACAGG + Intronic
953969617 3:47336903-47336925 GCAGATGGGGGCTCGCTCCCAGG - Intronic
954416780 3:50397129-50397151 GGAGCTGGGGCCTCCCTCCCTGG - Intronic
955346434 3:58165155-58165177 GCTGCTGGGGTCTCCCACACTGG + Intronic
959516674 3:107274812-107274834 GATGCTGGTGTCCCCCTCACTGG - Intergenic
961166228 3:124765677-124765699 GCAGCTGGGGGCCCATTCTTGGG - Intronic
961305680 3:125958225-125958247 GCAGGCGGCGGCCCCCTCGCCGG - Intergenic
961787858 3:129358264-129358286 GCAGCTGGGAGCCACCACCCTGG + Intergenic
961829277 3:129615208-129615230 GCTGCTGGAGACCCCCTCCCTGG + Intergenic
962318002 3:134370829-134370851 TCAGCAGGGGGGCCCCTCAGTGG + Exonic
962573437 3:136734585-136734607 GCAGCAGGGGGCACACTGACAGG + Intronic
963013155 3:140794444-140794466 GAAGTTTGGGGACCCCTCACTGG - Intergenic
964801484 3:160564433-160564455 GCAGCTGGTGGTCTCCTCTCAGG + Intronic
967846040 3:194043683-194043705 GCAGCTGGGGACTCCCTGAGAGG - Intergenic
968007606 3:195254026-195254048 GCACCAGGGGGCACCCCCACTGG + Intronic
968292490 3:197549460-197549482 GCAGCAGGGGCTCCCCTCAAAGG + Intronic
968615328 4:1575144-1575166 GCAGCTGGGGGCCACCCGGCAGG + Intergenic
968801471 4:2745974-2745996 GCAGCTGGGGGCCCCCTCACTGG - Intronic
968878714 4:3287875-3287897 GGAGCTGAGGGCCCCCACCCAGG - Intergenic
968884014 4:3317689-3317711 GAAGCTGGGGGCACCTCCACAGG - Exonic
969439331 4:7208134-7208156 GGAGCTGGGGGCCGCCTCGGTGG - Intronic
969640808 4:8397328-8397350 GCAGCTGGGTGTCCCCTCCCTGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
970774022 4:19651128-19651150 GAAGCTGGGGGAGCCCTCAGTGG - Intergenic
971327858 4:25658677-25658699 GCAGCGGGGGAGCCCCTCCCTGG + Intronic
971378926 4:26078786-26078808 ACAGCTGGTGGCCCTTTCACAGG + Intergenic
974047444 4:56908894-56908916 GCCGGAGGGGGCCCCCACACGGG - Intronic
976826515 4:89266332-89266354 GCAGCTGGTGGGCCTCTCTCTGG + Intronic
977666294 4:99650155-99650177 GGAGTTGGGGGGCCCCTCCCTGG + Exonic
984757434 4:183337518-183337540 CCAGCTGGGTGCCCCCAGACAGG - Intergenic
985119373 4:186624360-186624382 TCAGCTGGGGCCCCACTGACTGG + Intronic
985554087 5:547567-547589 GCAGGTGGGAGCCCCATCCCTGG - Intergenic
985600034 5:823503-823525 GCAGCTGTGGGCCCACTCCAAGG + Intronic
985686060 5:1282291-1282313 GGAGCCAGGGGCCCCGTCACAGG - Intronic
986061096 5:4191945-4191967 GCAGCTGGGGTCTCCCTGTCTGG - Intergenic
986201829 5:5586223-5586245 GCAGCTGGGGATCACCTCCCTGG + Intergenic
991214684 5:64148812-64148834 ACAGCTGGGGCTTCCCTCACAGG - Intergenic
992089327 5:73303513-73303535 CCAGCTGGGCGCCCACTCGCGGG - Intergenic
992930351 5:81637045-81637067 GCTGCTGGGGTCACCCTCACAGG - Intronic
995526515 5:113054762-113054784 TCAGCTGGGGGCTCCCTGCCTGG - Intronic
996065130 5:119071280-119071302 GAAGCTCAGGGTCCCCTCACCGG - Intronic
998393338 5:141801985-141802007 CCAGATGGGGGCCCCCCCAGTGG - Intergenic
999799519 5:155019870-155019892 GCAGCTGCGGCCGCCCTCCCAGG - Intergenic
1002047884 5:176552233-176552255 GCAGTTGGTGGCCCCCACTCTGG - Intronic
1007138661 6:39548741-39548763 GCAGCTGGGAGACCCCTTAGAGG - Intronic
1007942666 6:45797234-45797256 GCAGCTCAGGGCAGCCTCACAGG + Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1013167163 6:107604690-107604712 GTCACTGGGGGCGCCCTCACAGG - Intronic
1016216577 6:141610832-141610854 GAAGCTGGGCGGCCCCTCAAGGG - Intergenic
1018717813 6:166547433-166547455 GCAGCTGAGTGCCCGCTCTCCGG + Intronic
1019126595 6:169844990-169845012 TCAGCGGGGGCCTCCCTCACAGG - Intergenic
1019261494 7:84384-84406 GCCGCTGGGTCCCTCCTCACAGG + Intergenic
1019421763 7:954166-954188 GCAGCGGGGGGGCCCCCCCCAGG - Intronic
1021355736 7:19651444-19651466 GCCTCTGGGGGCCCCTTCCCAGG - Intergenic
1023591224 7:41782627-41782649 GTAGCTGGGTGCCCTCTGACAGG + Intergenic
1023855078 7:44177980-44178002 CCAGCTGGTTGCCACCTCACTGG + Intronic
1023865208 7:44235134-44235156 GCAGCTGGCCGCCCACTCAGAGG + Intronic
1024022821 7:45387090-45387112 GCAGCTGCCGACCCCCTCCCAGG - Intergenic
1028387425 7:90272946-90272968 GCAGCTGAAGGCAGCCTCACAGG + Intronic
1029443323 7:100600136-100600158 GGGGCTGGGGGCCGCCTCCCAGG + Exonic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1030555508 7:111019510-111019532 GTAGGTGGAGGCCCCCTTACTGG - Intronic
1034547999 7:151801508-151801530 GGAGCTGGGGGACCCCTCACAGG + Intronic
1035269677 7:157711971-157711993 GCAGCTGGGGGCACCATGAGTGG + Intronic
1035269720 7:157712075-157712097 GCAGCTGGGGGCACCATGAGTGG + Intronic
1035450894 7:158976280-158976302 GCAGCTGTGGCCGCCCTCCCGGG + Intergenic
1035632138 8:1116170-1116192 TCAGCTGGGGACACCCGCACTGG + Intergenic
1036179599 8:6572837-6572859 GCAGGAGGGAGCCCCCACACGGG + Intronic
1036711676 8:11083389-11083411 GCAGCTGGGAGCCACCTGTCAGG + Intronic
1039558748 8:38496111-38496133 ACAGCTGTGAGCCACCTCACCGG - Intergenic
1041717356 8:60944271-60944293 GCAGCTGTGGGCCCCTCCATAGG - Intergenic
1048726138 8:137387274-137387296 GGAGTTGGGAGCCCCCACACAGG - Intergenic
1049784438 8:144443863-144443885 GCAGGTGCGGGCGCCCTCACTGG - Exonic
1051867251 9:21696171-21696193 GCAACTGGCGGCCCCCTGGCGGG + Intergenic
1053459819 9:38259560-38259582 GCAGATGGTGGCCCCTCCACAGG + Intergenic
1053489175 9:38487029-38487051 GCACCTGGGAGCCCCCTGACTGG - Intergenic
1056732622 9:89178721-89178743 GCAGCTGGGCGCTCCATCAGAGG - Exonic
1057444403 9:95103729-95103751 GCACCTGGAGGCCCACTCCCCGG - Intronic
1057521347 9:95762928-95762950 GCACCTGGGAGTCCCATCACAGG + Intergenic
1057669530 9:97076343-97076365 GCACCTGGGAGCCCCCTGACTGG - Intergenic
1057705394 9:97391879-97391901 GAGGCTGGGGACCTCCTCACTGG + Intergenic
1060437135 9:123603615-123603637 GCAGCTGGGGGCCCCCCAACTGG + Intronic
1061001360 9:127904725-127904747 GCAGGTGGGGGCCTGCACACAGG + Intronic
1061130171 9:128703915-128703937 GGAGCTGGGGGCCCGGCCACCGG - Intronic
1061366140 9:130173067-130173089 GCAGCCGGGCGCCCCCTCCCGGG - Intronic
1061878043 9:133554658-133554680 GCCCCTGGGGGGCCCCTCGCAGG - Exonic
1203470026 Un_GL000220v1:112226-112248 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1203477847 Un_GL000220v1:156198-156220 GCGGCTGGGGGTTCCCTCGCAGG + Intergenic
1185619178 X:1442896-1442918 GCAGCCAGGGGCTCCCCCACTGG - Intronic
1186455657 X:9708096-9708118 CCAGCTTGGGGCTCCCTCAGGGG - Intronic
1187503922 X:19863643-19863665 CCAGCTGGGGACCCCGTCCCAGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1192333968 X:70202149-70202171 GAAGATGGGGGCCCTCTAACAGG - Intronic
1194647001 X:96469950-96469972 GCTGCTGGGGGCAACATCACAGG + Intergenic
1196752945 X:119133600-119133622 GCAGGTGTGAGCACCCTCACGGG + Intronic
1197704326 X:129622998-129623020 GCAGCTGTGCGCCCCCCCTCAGG + Intergenic
1199978490 X:152908054-152908076 GCATCTGTGGGCCTGCTCACTGG - Intergenic
1200082178 X:153583111-153583133 GCAGCTGGAGCCCCTCCCACTGG - Intergenic
1200399429 X:156010491-156010513 GCTGCTAGGGGCCCCTTCTCAGG - Exonic
1201277664 Y:12313800-12313822 GCAGCTGGGTGCCTCCGCTCAGG + Intergenic
1201357553 Y:13113107-13113129 GCAGCTGGGTGCCTCCGCTCAGG + Intergenic