ID: 968801471

View in Genome Browser
Species Human (GRCh38)
Location 4:2745974-2745996
Sequence GCAGCTGGGGGCCCCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968801471_968801485 18 Left 968801471 4:2745974-2745996 CCAGTGAGGGGGCCCCCAGCTGC 0: 1
1: 0
2: 2
3: 20
4: 258
Right 968801485 4:2746015-2746037 TGCACCCTGCTTACCTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 174
968801471_968801480 -8 Left 968801471 4:2745974-2745996 CCAGTGAGGGGGCCCCCAGCTGC 0: 1
1: 0
2: 2
3: 20
4: 258
Right 968801480 4:2745989-2746011 CCAGCTGCCCAGGGTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968801471 Original CRISPR GCAGCTGGGGGCCCCCTCAC TGG (reversed) Intronic