ID: 968802159

View in Genome Browser
Species Human (GRCh38)
Location 4:2750300-2750322
Sequence GTCTAGTACTTGAGGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968802150_968802159 13 Left 968802150 4:2750264-2750286 CCCCCAGAAGTGGCGGGAGAAGG 0: 1
1: 0
2: 0
3: 22
4: 187
Right 968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 78
968802154_968802159 11 Left 968802154 4:2750266-2750288 CCCAGAAGTGGCGGGAGAAGGGT 0: 1
1: 0
2: 2
3: 17
4: 155
Right 968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 78
968802147_968802159 21 Left 968802147 4:2750256-2750278 CCAAGCTTCCCCCAGAAGTGGCG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 78
968802152_968802159 12 Left 968802152 4:2750265-2750287 CCCCAGAAGTGGCGGGAGAAGGG 0: 1
1: 0
2: 4
3: 23
4: 211
Right 968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 78
968802146_968802159 22 Left 968802146 4:2750255-2750277 CCCAAGCTTCCCCCAGAAGTGGC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 78
968802155_968802159 10 Left 968802155 4:2750267-2750289 CCAGAAGTGGCGGGAGAAGGGTC 0: 1
1: 0
2: 5
3: 10
4: 102
Right 968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968802159 Original CRISPR GTCTAGTACTTGAGGTAAGA AGG Intronic
902186640 1:14730432-14730454 GTCAAGGACATGTGGTAAGAAGG - Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
912170455 1:107093091-107093113 ACCAAGTACTTGGGGTAAGATGG + Intergenic
914757655 1:150573650-150573672 GCCTTGATCTTGAGGTAAGAGGG - Intergenic
919529417 1:198697889-198697911 GTCTTGTACTTGCTGTAGGAAGG - Intronic
921492155 1:215790449-215790471 GTCTAGTGCTCTTGGTAAGAAGG - Intronic
921654476 1:217718490-217718512 GTCTTGTACTTGAACTTAGAAGG + Intronic
1063990578 10:11557712-11557734 CTCTAGTGCATGAGGAAAGAGGG + Intronic
1072121383 10:92408137-92408159 GTCTAGTCCCTAAGGCAAGAAGG + Intergenic
1077802526 11:5555231-5555253 GTAAAGTCCTTCAGGTAAGAAGG + Intronic
1080362938 11:31537146-31537168 TACTAGTACAAGAGGTAAGATGG + Intronic
1080944788 11:36958707-36958729 GCCTAGTCCTTGAGGCAAGGAGG - Intergenic
1088421276 11:109650161-109650183 GTCTAATACTGCAGGTATGAAGG - Intergenic
1089837781 11:121386585-121386607 GTATAGTACTAGAGGTGGGAAGG - Intergenic
1094279544 12:28720445-28720467 GGTCAGTACTTGAAGTAAGAGGG - Intergenic
1097986911 12:65793345-65793367 GTGGATTACTTGAGGTCAGAAGG - Intergenic
1098792706 12:74845829-74845851 GCCTAGTATTTGAGGAAATAGGG + Intergenic
1099396678 12:82148311-82148333 GTCTACTACTTGAGGGTGGAAGG - Intergenic
1099520820 12:83659327-83659349 CTGTAGTACTTGTGGTAACATGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1109288823 13:60447664-60447686 TTCTACTACTTGAGGTAGGTTGG + Intronic
1112707790 13:102091549-102091571 GGCTGGTATTTGAGGGAAGAAGG - Intronic
1112917270 13:104567024-104567046 GTCTAGTCCCTGAAGTGAGAGGG + Intergenic
1113258952 13:108539141-108539163 GTCCTGTACCTGAGTTAAGAGGG + Intergenic
1115742031 14:36398718-36398740 GGACAGTACTTGAGGTAATAGGG - Intergenic
1117470364 14:56038551-56038573 GTCAAGCACTAGAGGAAAGATGG - Intergenic
1119255999 14:73197475-73197497 GAGAAGTACTTGAAGTAAGAGGG - Intronic
1123216771 14:106815470-106815492 TTGTAGTATTTGAGGTAAAAAGG + Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1129648496 15:77461153-77461175 TTCTGGTACATCAGGTAAGATGG + Intronic
1131582571 15:93659386-93659408 GTATAGTACCTGAGGTAACAGGG + Intergenic
1134198137 16:12174950-12174972 ATCTTGTCCCTGAGGTAAGAGGG + Intronic
1138145385 16:54604521-54604543 GCCTAGTAACTGAGGTAAGGTGG - Intergenic
1138711440 16:58974855-58974877 GTCAAGTACTTAAGTTAAAATGG + Intergenic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
925636114 2:5942614-5942636 GTGTAGGACTTGGGGTCAGATGG + Intergenic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
933201263 2:79452308-79452330 GTCTAGTGGTTGAGGTATGAAGG - Intronic
935201906 2:100864288-100864310 GTCTAGAACTTAAGGTAATTTGG - Intronic
935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG + Intergenic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1170298193 20:14852474-14852496 GTTTAGTAGTGGAGGAAAGAGGG + Intronic
1175699584 20:61127358-61127380 GTATAGTAGATGAGGTAACAAGG + Intergenic
1177351103 21:19943066-19943088 GTCTAGTACTTTAGAGAATACGG + Intergenic
1182151246 22:28028599-28028621 GTGAAGGACTTGAGGTAGGAAGG + Intronic
958628901 3:96663731-96663753 GCCTTTTACTTGATGTAAGAAGG - Intergenic
959837437 3:110936652-110936674 TGCTATTCCTTGAGGTAAGATGG + Intergenic
962015774 3:131438873-131438895 GTTTAGGACTTGAGGAGAGAAGG + Intergenic
963652262 3:147994719-147994741 GTCTAGTGCTTCAGCTGAGAAGG - Intergenic
964965107 3:162482316-162482338 TTCTACTCCTTGAGGAAAGAAGG - Intergenic
965355058 3:167663682-167663704 TTCTAGTACTTAATTTAAGAAGG + Intergenic
966255819 3:177915836-177915858 GTTTACAACTTGATGTAAGATGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG + Intronic
974328339 4:60444323-60444345 GTCTAGTGCTGAAGGTAAAATGG + Intergenic
983511800 4:168616883-168616905 CTCTATTACTTGAGGCATGAGGG - Intronic
987819461 5:22943570-22943592 ATCTAGTACTTGATCTATGATGG + Intergenic
988657081 5:33224097-33224119 GTCTGTTACTTGAGGATAGATGG - Intergenic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
995504457 5:112844874-112844896 TTCTGGTATTTGAGGTGAGATGG + Exonic
1004988937 6:21115062-21115084 GCCTAGTCTTTGAGGAAAGAAGG - Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1011691534 6:89874608-89874630 TTCTAGTACTTGCTGTGAGAAGG - Intergenic
1014896795 6:126911074-126911096 GTCTAGTACTTAAGGTGATTGGG - Intergenic
1015060047 6:128952317-128952339 GTCTAGTGCTTGTGGTAATCTGG + Intronic
1015657547 6:135536384-135536406 GTTTAGTTATTGAGGTCAGAAGG - Intergenic
1020285621 7:6677658-6677680 TTTGAGTACTTGAGGTAAGATGG + Intergenic
1022857011 7:34324715-34324737 GCCTAGTTCCTGAGATAAGAAGG + Intergenic
1026881122 7:73907560-73907582 GTGTATAACTTGAGGTCAGAAGG - Intergenic
1036489943 8:9215534-9215556 GTCTAATCCTTGAAGAAAGAGGG - Intergenic
1036546862 8:9779592-9779614 GACTAGTAATTTAGGAAAGAGGG - Exonic
1044408115 8:91853881-91853903 GTCTTGGCTTTGAGGTAAGAAGG + Intergenic
1044464294 8:92485514-92485536 GTCTACTACTTCATGGAAGAAGG + Intergenic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1053307246 9:36993723-36993745 GTCTGGAACTTGAGGTGAAATGG - Intronic
1059884911 9:118735240-118735262 GTTTAGAACCTGAGGTTAGAAGG + Intergenic
1060739986 9:126091674-126091696 CACTAGTCCTGGAGGTAAGAAGG + Intergenic
1192902882 X:75519032-75519054 GGCTAGGACTTGGGGGAAGAGGG + Intronic
1195197683 X:102516048-102516070 GTCTAGTGCTTGGGGTAGAATGG + Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1197595286 X:128456713-128456735 GTCTAGTCCTTGAGGATAAAGGG + Intergenic
1198280234 X:135134311-135134333 GTCCAGTTCTTGAGGCAAGGAGG + Intergenic
1198290724 X:135238203-135238225 GTCCAGTTCTTGAGGCAAGGAGG - Intergenic
1198569436 X:137939431-137939453 GTCTAGTAATTGATTTAAGATGG + Intergenic