ID: 968803194

View in Genome Browser
Species Human (GRCh38)
Location 4:2756303-2756325
Sequence CGGCGGCCGCGCGGCCTCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968803194_968803199 -6 Left 968803194 4:2756303-2756325 CCCGGGAGGCCGCGCGGCCGCCG 0: 1
1: 1
2: 3
3: 31
4: 351
Right 968803199 4:2756320-2756342 CCGCCGGCAACTTCCGCGCCCGG 0: 1
1: 0
2: 1
3: 4
4: 46
968803194_968803200 -5 Left 968803194 4:2756303-2756325 CCCGGGAGGCCGCGCGGCCGCCG 0: 1
1: 1
2: 3
3: 31
4: 351
Right 968803200 4:2756321-2756343 CGCCGGCAACTTCCGCGCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
968803194_968803202 4 Left 968803194 4:2756303-2756325 CCCGGGAGGCCGCGCGGCCGCCG 0: 1
1: 1
2: 3
3: 31
4: 351
Right 968803202 4:2756330-2756352 CTTCCGCGCCCGGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 209
968803194_968803209 20 Left 968803194 4:2756303-2756325 CCCGGGAGGCCGCGCGGCCGCCG 0: 1
1: 1
2: 3
3: 31
4: 351
Right 968803209 4:2756346-2756368 CCGCCGGCTGCCGCCCTTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968803194 Original CRISPR CGGCGGCCGCGCGGCCTCCC GGG (reversed) Exonic