ID: 968805877

View in Genome Browser
Species Human (GRCh38)
Location 4:2772109-2772131
Sequence GCTCCCGTCATGCTGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968805866_968805877 21 Left 968805866 4:2772065-2772087 CCTGCACTGGAGAATGCAGGGAG No data
Right 968805877 4:2772109-2772131 GCTCCCGTCATGCTGCAGTGGGG No data
968805863_968805877 24 Left 968805863 4:2772062-2772084 CCTCCTGCACTGGAGAATGCAGG No data
Right 968805877 4:2772109-2772131 GCTCCCGTCATGCTGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968805877 Original CRISPR GCTCCCGTCATGCTGCAGTG GGG Intergenic
No off target data available for this crispr