ID: 968807800

View in Genome Browser
Species Human (GRCh38)
Location 4:2786838-2786860
Sequence ATGGAGAAGTGGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968807786_968807800 16 Left 968807786 4:2786799-2786821 CCACAAGTGTGGAATTAAGGCCA No data
Right 968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG No data
968807785_968807800 17 Left 968807785 4:2786798-2786820 CCCACAAGTGTGGAATTAAGGCC No data
Right 968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG No data
968807789_968807800 -4 Left 968807789 4:2786819-2786841 CCAAGGTCCACTCCCAAGGATGG No data
Right 968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968807800 Original CRISPR ATGGAGAAGTGGAAGGGGGA GGG Intergenic
No off target data available for this crispr