ID: 968810470

View in Genome Browser
Species Human (GRCh38)
Location 4:2797481-2797503
Sequence GACCGCTGGCAGGTGCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968810460_968810470 29 Left 968810460 4:2797429-2797451 CCTGGGCTAGGCATGCACTGCAA 0: 1
1: 0
2: 1
3: 20
4: 94
Right 968810470 4:2797481-2797503 GACCGCTGGCAGGTGCCCATGGG No data
968810459_968810470 30 Left 968810459 4:2797428-2797450 CCCTGGGCTAGGCATGCACTGCA 0: 1
1: 0
2: 0
3: 15
4: 145
Right 968810470 4:2797481-2797503 GACCGCTGGCAGGTGCCCATGGG No data
968810466_968810470 -5 Left 968810466 4:2797463-2797485 CCACAGGTCAGAGGGCAGGACCG 0: 1
1: 1
2: 0
3: 15
4: 203
Right 968810470 4:2797481-2797503 GACCGCTGGCAGGTGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968810470 Original CRISPR GACCGCTGGCAGGTGCCCAT GGG Intronic
No off target data available for this crispr