ID: 968811906

View in Genome Browser
Species Human (GRCh38)
Location 4:2803912-2803934
Sequence GTGACAGTAGCTTGGATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968811898_968811906 6 Left 968811898 4:2803883-2803905 CCCTAACAGATTGGGAGCCCAGA 0: 1
1: 0
2: 0
3: 11
4: 203
Right 968811906 4:2803912-2803934 GTGACAGTAGCTTGGATCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 133
968811897_968811906 9 Left 968811897 4:2803880-2803902 CCTCCCTAACAGATTGGGAGCCC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 968811906 4:2803912-2803934 GTGACAGTAGCTTGGATCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 133
968811899_968811906 5 Left 968811899 4:2803884-2803906 CCTAACAGATTGGGAGCCCAGAC 0: 1
1: 0
2: 0
3: 18
4: 333
Right 968811906 4:2803912-2803934 GTGACAGTAGCTTGGATCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968811906 Original CRISPR GTGACAGTAGCTTGGATCCC GGG Intronic
900542691 1:3212055-3212077 GTGACAGTAACAAGGCTCCCGGG + Intronic
900805960 1:4768662-4768684 AGGACAGTTGCTTGGATCTCAGG + Intronic
902304355 1:15525108-15525130 GTGACAGAAGGATGGATCCTGGG - Intronic
902529846 1:17083910-17083932 GTGACAGCAGCTGGTATCTCTGG + Intronic
902984321 1:20146391-20146413 GTGCTAATACCTTGGATCCCTGG - Intronic
904365182 1:30006270-30006292 ATTACAGCAGCCTGGATCCCTGG + Intergenic
908650555 1:66328582-66328604 GTGCCAGTGGCTTGGAGCCTTGG + Intronic
908670766 1:66544938-66544960 GTGACTCTAGCTTGGCTACCTGG - Intronic
909178917 1:72395598-72395620 GTTTCAGTAGCTTGGATTACAGG + Intergenic
909633906 1:77794572-77794594 GTGATAGTAGCTTTGATCACTGG + Intronic
912500939 1:110121506-110121528 TGGACAGTAGCTTTGATCCTGGG - Intergenic
917149744 1:171930593-171930615 GTGGGAGAAGCATGGATCCCTGG + Intronic
917780379 1:178389032-178389054 GTGGAAGTAGCACGGATCCCAGG + Intronic
923013845 1:230110391-230110413 GTGACAGTAGTGGGGCTCCCAGG - Intronic
1067094717 10:43292758-43292780 GTCACAGAAGCTTGAATCCATGG + Intergenic
1067489301 10:46683269-46683291 GTGACAATATCTTTGATTCCTGG + Intergenic
1067605369 10:47657116-47657138 GTGACAATATCTTTGATTCCTGG - Intergenic
1068280737 10:54865576-54865598 GTGGCAGGTGATTGGATCCCGGG - Intronic
1069845942 10:71371536-71371558 GTCACTGTAGCTTGGCACCCAGG - Intergenic
1071620929 10:87118511-87118533 GTGACAATATCTTTGATTCCTGG - Intronic
1077266895 11:1655334-1655356 CTGACAGCCCCTTGGATCCCAGG + Intergenic
1079894703 11:26103667-26103689 GTGATAGTAACTTTGATCTCTGG - Intergenic
1081191536 11:40108792-40108814 GTGAAAGTAGATTGTATCCCTGG - Intergenic
1081200195 11:40206037-40206059 CTGACAGTACCTTGTATCCTAGG + Intronic
1081842315 11:46211527-46211549 GTGACAGAAGCTTGGGCCCTAGG - Intergenic
1086813266 11:91336414-91336436 TTCACAGTAGCTTGGTTCTCAGG + Intergenic
1087648104 11:100831580-100831602 GTAGCAGTAGCTTGGATGGCAGG - Intronic
1088825482 11:113490258-113490280 GACACAGTAGCCTAGATCCCAGG - Intergenic
1088842425 11:113638285-113638307 GTGCCTGTAGTTTGGACCCCAGG - Intergenic
1089781083 11:120873747-120873769 GTGGCAGTTGCTTGTTTCCCTGG + Intronic
1094486242 12:30927802-30927824 GTGTCAGTAGCATTGTTCCCTGG + Intronic
1094587403 12:31790221-31790243 TTGACAGTAGCTGGGATTACAGG + Intergenic
1098016139 12:66106940-66106962 GAGACAGTAGCTGGGATTACAGG + Intergenic
1102242483 12:111333689-111333711 GTGATAGTAACTTGGATCATTGG + Intronic
1104610838 12:130226358-130226380 GTGACAGAAGCTTACATTCCAGG - Intergenic
1108800930 13:54093223-54093245 GTGACAGAAATATGGATCCCTGG + Intergenic
1118785808 14:69044498-69044520 GTGACAGCCTCTTGGATTCCTGG - Intergenic
1118808994 14:69260324-69260346 CTGACCGTAGCCTGGATCCTGGG + Exonic
1122059736 14:99129020-99129042 GAGTCAGCAGCCTGGATCCCTGG - Intergenic
1122244458 14:100392411-100392433 GTGACAGAGGCTTGGACCCCTGG - Intronic
1126805135 15:52340369-52340391 GTGACTGCAGCTGGGATTCCAGG + Exonic
1128065168 15:64760039-64760061 GTGGCAGCAGCTTGAATGCCAGG - Intronic
1131098950 15:89673247-89673269 GCGCCAGTAGCTTGGCTGCCTGG - Exonic
1132856403 16:2047036-2047058 GTGGCAGGAGCTTTGATGCCAGG - Intronic
1133662529 16:7933172-7933194 GTGACAGGAGGTTGGATACAAGG - Intergenic
1137312687 16:47281221-47281243 GTGTCAGTGGCTTGGATCACTGG + Intronic
1138080782 16:54089070-54089092 ATGACAGTACCTGAGATCCCTGG - Intronic
1139015587 16:62684977-62684999 GTGACAGCAGCTGGCATACCTGG + Intergenic
1140932881 16:79644074-79644096 GTGCCTGTGGCTTGGTTCCCTGG + Intergenic
1141422178 16:83924453-83924475 GTGACAGAGGCTTGAACCCCCGG + Exonic
1141679628 16:85536647-85536669 ATGGCAGTGGCTTGGAACCCAGG + Intergenic
1151069376 17:71190821-71190843 GTGGCAGTAGCAGGGTTCCCAGG + Intergenic
1158797103 18:60859949-60859971 GTGTCAGCAGATTGGATTCCTGG - Intergenic
924963509 2:56355-56377 GTTGCAGTAGCCTGGGTCCCAGG - Intergenic
927403489 2:22741581-22741603 ATGAGAGTAGCTTTGATTCCTGG + Intergenic
927796665 2:26055346-26055368 GAGACAGTAGCTGGGATTACAGG + Intronic
930276858 2:49321236-49321258 GAGACAGTAACTTGAATCCATGG + Intergenic
933562356 2:83903948-83903970 GTGACATGAGCTTGGCTCACTGG - Intergenic
933844447 2:86314244-86314266 GTGGCAGCAGCTTGGATGCCTGG + Intronic
935450126 2:103199890-103199912 GTGACAATAGCCTGGATCATTGG - Intergenic
937800849 2:126078645-126078667 GTGACAGTAGCTTGCAGAGCTGG + Intergenic
938237196 2:129715922-129715944 GTGACAGTAACTGGGATCTAAGG - Intergenic
939875585 2:147573753-147573775 ATCACAGTAGCTTGGACTCCAGG - Intergenic
941695960 2:168551009-168551031 GTGCCAGGAGCTTGGATTCTTGG - Intronic
942166295 2:173244062-173244084 GTGACAGTGCCATGGGTCCCAGG + Intronic
942329236 2:174804563-174804585 ATGACAGTAGCTTGGACCAGGGG + Intronic
942838932 2:180336545-180336567 CTGCCAGCAGCTTGGATCCTAGG - Intergenic
942839434 2:180341276-180341298 CTGCCAGCAGCTTGAATCCCAGG - Intergenic
948348037 2:237315463-237315485 GGGACAGGAGCATGGATCCTGGG + Intergenic
948737467 2:240018313-240018335 GTGAAAGCAGATTGGAGCCCTGG - Intronic
1168941209 20:1712796-1712818 CTTACAGTAGCCTGGCTCCCAGG + Intergenic
1174814373 20:53674291-53674313 GTGAGAGTAGCTGGGATTACAGG + Intergenic
1175900600 20:62358500-62358522 GTGCCACTGGCTTGGCTCCCTGG - Intronic
1179909309 21:44439456-44439478 GTGACAGCTGCTTGGAGGCCTGG + Intronic
1181256421 22:21565849-21565871 GTGACAGTGGTTTGGACCTCAGG - Intronic
1181770709 22:25123314-25123336 GGGACAGTAGCTGGGATTACAGG + Intronic
1183402366 22:37612028-37612050 CTGAGAGTAGCTGGGATCACAGG - Intronic
954974250 3:54678112-54678134 GTTCCAGGAGCTTAGATCCCTGG + Intronic
955933563 3:64080951-64080973 TTGAGTGTGGCTTGGATCCCAGG - Intergenic
957355145 3:79073813-79073835 GTGACAGTATGTTTGCTCCCTGG + Intronic
959923206 3:111892509-111892531 GTGACTGTAGTTTGCATCCCTGG + Intronic
964007168 3:151845708-151845730 GAGATAGGAGCTTGGGTCCCTGG - Intergenic
965268752 3:166584952-166584974 GAAACAGTTGCTTGGACCCCAGG + Intergenic
967141304 3:186563108-186563130 GTGATAGAAGCATGGATCCCTGG + Intronic
968811906 4:2803912-2803934 GTGACAGTAGCTTGGATCCCGGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969094934 4:4725422-4725444 CTGACAGTAGACTGGGTCCCTGG - Intergenic
969258602 4:6019923-6019945 GTGACAGAAGGGTGGAACCCAGG + Intergenic
969444975 4:7239511-7239533 GTGACAGTAGCTTTCACCCAGGG - Intronic
969512999 4:7630252-7630274 GTGAAAAAAGCTTGAATCCCAGG + Intronic
975825028 4:78310289-78310311 GTGACAGTAACCAGCATCCCAGG - Intronic
976681218 4:87758252-87758274 GGCCCAGTAGCTGGGATCCCAGG - Intergenic
980527431 4:134010592-134010614 CTGCAGGTAGCTTGGATCCCTGG - Intergenic
983163948 4:164451872-164451894 GTTGCAGTAGCCTGGATCCTGGG - Intergenic
985490413 5:175551-175573 GTGTCTGTAGCTTGGGTGCCTGG - Intronic
988400177 5:30751971-30751993 GTGACATTGACTTGAATCCCAGG + Intergenic
988504655 5:31811360-31811382 GTCACAGAAACTTGGATGCCAGG + Intronic
988692380 5:33585620-33585642 GTCACAGTAACTTTGATACCTGG + Intronic
988794533 5:34640309-34640331 GTGGTAGTAGCTGGGATCCTGGG - Intergenic
988918408 5:35919198-35919220 GTGAAATTAGTTTGGATCTCAGG + Intronic
988975884 5:36515489-36515511 GAGCCAGTAGCTAGGATCCTTGG - Intergenic
989251771 5:39325263-39325285 GTGACAGTAGCTTGGCTAGATGG - Intronic
989280767 5:39640477-39640499 GTGACAGGAGCCAGCATCCCTGG + Intergenic
990621936 5:57569386-57569408 ATGAAAGTAGCATGGATCACTGG - Intergenic
992989423 5:82269015-82269037 GTGCCAGTACCTGGGATTCCAGG - Intronic
997750362 5:136338768-136338790 GGGACCCTATCTTGGATCCCAGG + Intronic
1004654454 6:17645127-17645149 CTGCCAGTAGCTTGGATTACAGG - Intronic
1004804824 6:19191565-19191587 GTGATAGTAGCTGGGATGCTGGG - Intergenic
1010670731 6:78683051-78683073 CTGACTGCAGCTTGAATCCCAGG + Intergenic
1015168633 6:130226693-130226715 CTGACAGTAGCTGGGATTACAGG - Intronic
1024119485 7:46222408-46222430 GTGACAATCGCTTGAACCCCGGG - Intergenic
1024849658 7:53696524-53696546 GAAACAGGAGCTTGGATCTCTGG - Intergenic
1026019951 7:66698686-66698708 GGGACAGCACCTTGGAGCCCTGG - Intronic
1030711839 7:112758731-112758753 GTGACAGTAGTTTAGTTCCTTGG + Intergenic
1032826818 7:135578840-135578862 CTAACAGTGGCTTGGAGCCCAGG - Exonic
1033333929 7:140436366-140436388 GTAGCAGTAGCTGGGATCGCAGG + Intergenic
1033450933 7:141462000-141462022 GAAACAGAAACTTGGATCCCTGG - Intronic
1036286897 8:7450788-7450810 GTGACATTTGCTCTGATCCCTGG - Exonic
1036334581 8:7860736-7860758 GTGACATTAGCTCTGATCCCTGG + Intronic
1038230737 8:25697385-25697407 CTGAGAGTAGATTGAATCCCTGG + Intergenic
1042229193 8:66539889-66539911 GTGACCCGAGCTTGGTTCCCAGG + Intergenic
1047385951 8:124409466-124409488 TTTACAGTATCTTGGATCACAGG - Intergenic
1049473879 8:142788056-142788078 GAGACATTTGCTGGGATCCCCGG - Intergenic
1049796581 8:144499860-144499882 GTGCCAGGAACCTGGATCCCTGG + Intronic
1050104798 9:2154574-2154596 GTTGCAGTAGCGTGGAACCCTGG + Intronic
1051733204 9:20169585-20169607 ATCACTGTAGCTTGGCTCCCAGG + Intergenic
1055717013 9:79128804-79128826 CTGACAGTAGCTGAGATCCTGGG - Intergenic
1058741361 9:107945839-107945861 GAGATAGTAGCTGGGATCCAAGG - Intergenic
1061138709 9:128751547-128751569 GTGTCAGTGGCTTGGGACCCAGG + Intronic
1061612760 9:131759058-131759080 GTGACAGTGGCTTAGATGGCTGG - Intergenic
1062111177 9:134782860-134782882 GGGACAGTGGCGTGGAGCCCAGG + Intronic
1188244855 X:27827290-27827312 ATGGAAGTAGCCTGGATCCCTGG + Intergenic
1190012903 X:46800698-46800720 ATTACAGTGGCTTGAATCCCAGG - Intergenic
1191091167 X:56623664-56623686 CTGACAGTAGCTGGGACCACAGG + Intergenic
1191757436 X:64608987-64609009 GTGACAGTGGCTTGGTTACTAGG + Intergenic
1192624073 X:72709917-72709939 CTCACAGTAGCTGGGATCACAGG - Intronic
1192779801 X:74282668-74282690 GTGAGAGTAGCTGGGATTACAGG + Intergenic
1195792949 X:108609029-108609051 GTGACTGTATCATGGATACCTGG + Intronic
1196095199 X:111791355-111791377 GTGACAGCAGCTTGGGCCCATGG - Intronic
1198934411 X:141890905-141890927 GTGAAAGCAGCTTGGATTCCTGG + Intronic
1198935700 X:141901159-141901181 GTGACAGCAGCTTGGATTCCTGG + Intergenic
1199623443 X:149719114-149719136 GTGGAAGCAGCCTGGATCCCTGG + Intergenic
1199893483 X:152111078-152111100 GTGGAAGTAGCATGGATCCCTGG - Intergenic
1199950877 X:152705081-152705103 GTGGAAGCAGCTTGGATTCCTGG + Intergenic
1199953187 X:152721662-152721684 GTGGAAGCAGCTTGGATCCCTGG + Intergenic
1199956495 X:152746784-152746806 GTGGAAGCAGCTTGGATCCCTGG - Intergenic
1199958805 X:152763380-152763402 GTGGAAGCAGCTTGGATTCCTGG - Intergenic