ID: 968812613

View in Genome Browser
Species Human (GRCh38)
Location 4:2806748-2806770
Sequence TGGGAGTCGGGACTGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968812613_968812629 29 Left 968812613 4:2806748-2806770 CCCCCGGGCAGTCCCGACTCCCA 0: 1
1: 0
2: 1
3: 4
4: 124
Right 968812629 4:2806800-2806822 AGAGACACCAGGCCTGAGAGAGG No data
968812613_968812624 3 Left 968812613 4:2806748-2806770 CCCCCGGGCAGTCCCGACTCCCA 0: 1
1: 0
2: 1
3: 4
4: 124
Right 968812624 4:2806774-2806796 CCATCTCAAGAACCTTTCCTGGG No data
968812613_968812627 18 Left 968812613 4:2806748-2806770 CCCCCGGGCAGTCCCGACTCCCA 0: 1
1: 0
2: 1
3: 4
4: 124
Right 968812627 4:2806789-2806811 TTCCTGGGGACAGAGACACCAGG 0: 1
1: 0
2: 10
3: 53
4: 328
968812613_968812622 2 Left 968812613 4:2806748-2806770 CCCCCGGGCAGTCCCGACTCCCA 0: 1
1: 0
2: 1
3: 4
4: 124
Right 968812622 4:2806773-2806795 CCCATCTCAAGAACCTTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 181
968812613_968812625 4 Left 968812613 4:2806748-2806770 CCCCCGGGCAGTCCCGACTCCCA 0: 1
1: 0
2: 1
3: 4
4: 124
Right 968812625 4:2806775-2806797 CATCTCAAGAACCTTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968812613 Original CRISPR TGGGAGTCGGGACTGCCCGG GGG (reversed) Intronic
900101502 1:964050-964072 TGGGAGTGGGGTCTCCACGGTGG - Intronic
900396792 1:2456364-2456386 TGGGAGGCGGGGCGGCCCTGGGG + Intronic
900659800 1:3776773-3776795 TGGGAGGGGGGCCTGCCCCGGGG - Intergenic
900759882 1:4463461-4463483 TGGGAGTGGGGGCTGTCCTGGGG - Intergenic
902075425 1:13780836-13780858 TGGAAGTGGGGACTGTGCGGTGG - Exonic
903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG + Intronic
903245313 1:22010793-22010815 TGGGAGTGGGGACCACCAGGTGG + Intronic
903285615 1:22275062-22275084 TGTGAGTGGGGAGTGCCCGAGGG - Intergenic
903371811 1:22841393-22841415 AGGGAGTCTGGACTGCAGGGAGG + Intronic
912941977 1:114053256-114053278 TGTTTGTCGGGACTGCCCTGTGG + Intergenic
920367687 1:205456687-205456709 TGCGGGTCGGGACTGGCCGGGGG - Intergenic
922740577 1:228012134-228012156 TAGGGGTGGTGACTGCCCGGTGG + Intronic
923046228 1:230357481-230357503 TGGGAGCCGGCACTGTCAGGTGG - Intronic
923299850 1:232630550-232630572 TGGGAGACGGGAGGGCCGGGTGG - Intergenic
1064201435 10:13288343-13288365 TGGGAGGTAGGTCTGCCCGGCGG - Exonic
1070714361 10:78708359-78708381 TAGGAGTCGGCACAGCCAGGAGG - Intergenic
1070931712 10:80265813-80265835 TGGGAGTGGGGTCGGCCTGGTGG + Intergenic
1075390779 10:122089836-122089858 TGGGAGTCACTACTGCCAGGCGG - Intronic
1076164116 10:128268347-128268369 TGGGAGTCCTGATTGCCCAGGGG - Intergenic
1076704495 10:132293802-132293824 TGGGGGTGGGGACAGCCCCGAGG + Intronic
1076880359 10:133236715-133236737 CGGGAGTCGGGGCTGCTCCGTGG + Intergenic
1077155866 11:1090546-1090568 TGGGACTCAGGGCTGCTCGGGGG + Intergenic
1094291125 12:28851421-28851443 TTGGATTGGGGACTGCCCAGGGG + Intergenic
1094849074 12:34374261-34374283 TGGGACCCGCGACTGCGCGGTGG + Intergenic
1102584505 12:113913841-113913863 TGGGATCCAGGACTGCTCGGGGG - Intronic
1105965924 13:25384859-25384881 TGGCAGTCGGGAGTCCCAGGAGG + Intronic
1106112340 13:26787804-26787826 GGGGAGTCGGGGCTGACAGGAGG - Intergenic
1107987650 13:45789032-45789054 TGGGAGTCAGGTCTGCTAGGAGG + Intronic
1110356786 13:74575974-74575996 TGGGAGTGGGGACAGCGAGGGGG + Intergenic
1117954569 14:61112686-61112708 AGGGAGTGGGGACAGCCCCGTGG - Intergenic
1118295453 14:64564220-64564242 TGGGAGGCAGGATTGCCTGGTGG + Intronic
1122234233 14:100323024-100323046 GGGGAGTCGGGAAAGCCCAGGGG + Intergenic
1122693454 14:103542106-103542128 AGGGTGGCGGCACTGCCCGGCGG - Intergenic
1122953914 14:105061159-105061181 AGGGAGTCGGGACGTCCCAGTGG - Intronic
1124426433 15:29567219-29567241 TGGGTGTCAGGCCTGGCCGGAGG - Intronic
1132177612 15:99727906-99727928 TGGGAGTTGGTGCTGCCCTGTGG - Exonic
1132499146 16:276954-276976 AGTGAGCCGAGACTGCCCGGTGG - Intronic
1133739737 16:8641977-8641999 AGGGAGTCTGGTCTGCCTGGTGG + Intronic
1133922175 16:10163167-10163189 TGGGAGTGGGGAGTGGGCGGTGG + Intronic
1134102675 16:11462950-11462972 TGGGAGCCGGGAGAGCCAGGAGG - Intronic
1146706853 17:35006878-35006900 GGGGAGTAGGGACAGCACGGGGG + Exonic
1147440307 17:40443584-40443606 GGGGAGACGGGGCGGCCCGGCGG - Exonic
1147591999 17:41689517-41689539 GGGGAGTCCGGGCTGCCAGGCGG - Intronic
1148846576 17:50533305-50533327 GGGGAGGGGGGACTGCCCTGAGG - Intronic
1151669346 17:75563477-75563499 TGGGGGTGGGCCCTGCCCGGCGG - Intronic
1151712610 17:75815271-75815293 TGGGAGAGGGCACTGCCCCGGGG - Intronic
1152690049 17:81713842-81713864 GGGGAGGCGGGACTGCCCTCTGG + Intronic
1153805636 18:8706438-8706460 GGGGGCTCGGGGCTGCCCGGCGG - Intronic
1154329224 18:13415817-13415839 GGGGAGCCTGGGCTGCCCGGAGG + Intronic
1159873490 18:73785127-73785149 TGGGAGTGGGGCCTGCTGGGAGG - Intergenic
1160831975 19:1108431-1108453 TGGGCGTCGGGGGTGCCCAGCGG + Exonic
1163772348 19:19198729-19198751 TGGGAGTCGGGAGTGGCCCTGGG + Intronic
1167852128 19:52210320-52210342 TGGGGCTCGGGACTGCTCGCTGG - Intronic
926423329 2:12718807-12718829 AGGGCGGCGGGACTGCGCGGGGG + Intronic
931321467 2:61177667-61177689 CGGGAGCCGGGGCTGCCCTGGGG + Exonic
937901666 2:127024733-127024755 AGGGAGTGGGGACTGCAGGGAGG + Intergenic
937980637 2:127612598-127612620 TGGGAGTGGGAACTGACCTGAGG - Exonic
942422456 2:175821922-175821944 TGGGAGATGGGACTGCGAGGGGG - Intergenic
1168742199 20:201260-201282 TGGGAGTGGGGAGTGCAGGGTGG + Intergenic
1169110175 20:3027608-3027630 AGGGAATGGGGACTGCTCGGAGG - Intronic
1169860849 20:10150766-10150788 TGGAAGTGGGGACTGGCGGGAGG - Intergenic
1172829915 20:37824908-37824930 TGGTATTTGGGACTTCCCGGAGG - Intronic
1173847171 20:46195565-46195587 TGGGAGGCGGGAGTGCCAAGGGG - Intronic
1174067374 20:47875189-47875211 TGGGAGGTGGGACTGGACGGGGG + Intergenic
1174156927 20:48521685-48521707 TGGGAGGTGGGACTGGACGGGGG - Intergenic
1176161093 20:63649212-63649234 TGGGAGTGAGGCCTGCCCTGTGG + Intronic
1176309999 21:5144529-5144551 TGGGATTCGGGTGTGCCTGGCGG - Intronic
1177437457 21:21074615-21074637 TGGGAGTCGGGTTTGGCAGGTGG + Intronic
1179847057 21:44117503-44117525 TGGGATTCGGGTGTGCCTGGCGG + Intronic
1181688948 22:24547696-24547718 TTGCAGTCGGGCCTGCCCAGAGG - Intronic
1183708562 22:39489370-39489392 TGGGAGACCGGCCTGCCAGGAGG + Exonic
1183772488 22:39938821-39938843 TGGGAGTGGGGAGCGCCCTGGGG + Intronic
1184291122 22:43498688-43498710 AGGGAGTTAGGGCTGCCCGGAGG - Intronic
1184361189 22:44019795-44019817 TGGGAGTCGGGCCTGATGGGGGG - Intronic
1184405636 22:44298936-44298958 TGGGAGCCGGGACAACCGGGTGG + Intronic
1184998509 22:48227572-48227594 TGGGAGTGGGTGCTGCCCGGAGG + Intergenic
1185058055 22:48591559-48591581 AGGGAGTGGGCACTGACCGGGGG + Intronic
961487597 3:127227630-127227652 TGGGAGTCAGCCCTGCCAGGTGG + Intergenic
961523657 3:127483163-127483185 TGGGAGTCGGGAGTGCCCAGGGG - Intergenic
968455805 4:699063-699085 TGGGAGCCGGAAGTGCCCGCAGG - Intergenic
968812613 4:2806748-2806770 TGGGAGTCGGGACTGCCCGGGGG - Intronic
969300052 4:6292308-6292330 TGGGGGTGGGGACTGGCGGGGGG + Intronic
969495780 4:7525469-7525491 TGGGAGTCAGGACTGCCCCCGGG - Intronic
969626698 4:8309268-8309290 AGGGAGGCGGCTCTGCCCGGAGG - Intergenic
970428058 4:15963556-15963578 TGGGAGTCTGGGCTGCCTCGAGG + Intronic
980878845 4:138689030-138689052 TGGGAGTCAGGCCTGACCGAGGG - Intergenic
984778955 4:183506164-183506186 AGGGAGTCGGGGCTGTGCGGGGG + Intronic
985036531 4:185846023-185846045 AAGGAGTTGGGACTGCCAGGTGG - Intronic
986728633 5:10618512-10618534 CGGGAGCCCGGGCTGCCCGGCGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
993022175 5:82605210-82605232 TGGGAATGTGGACTGCCAGGGGG - Intergenic
997647225 5:135489463-135489485 TGGGTGTCGGGACTGGAGGGAGG + Intergenic
998419313 5:141969205-141969227 TGGGGTTCGGCACTGCCGGGCGG + Intronic
1001274302 5:170339189-170339211 GGGGAGCCGGGACTGCCCTTGGG - Intergenic
1001433067 5:171678691-171678713 TGGGAGTCAGGGCTTCCAGGAGG - Intergenic
1006635690 6:35459774-35459796 TGGCAGTGGGGACAGCACGGAGG - Intronic
1011448985 6:87473037-87473059 TGGGAGTGGGGAGTCCGCGGGGG + Intronic
1018741033 6:166728782-166728804 TGGGCATGGGGACTGCCTGGAGG + Intronic
1018778703 6:167043339-167043361 TGGGAGCACGGACTGCTCGGAGG - Exonic
1018893735 6:167999879-167999901 TGGGAGTGGGGATTTCCAGGGGG - Intronic
1019051959 6:169190348-169190370 GGGGAGAGGGAACTGCCCGGGGG - Intergenic
1019469791 7:1213093-1213115 TGTGAGTTTCGACTGCCCGGTGG + Intergenic
1020377174 7:7501437-7501459 TGGGAGGAGGGACTGCACAGTGG - Intronic
1023882374 7:44327677-44327699 TCGGAGGAGGGACTGCCTGGGGG - Intronic
1028480481 7:91299446-91299468 TGGGAGTGGGGACTGCAGAGGGG - Intergenic
1029188556 7:98756050-98756072 TGGGAGTCAGGGATGCCCGGGGG - Intergenic
1029443838 7:100602312-100602334 TGGGCGTGGGGACTGGCCAGTGG - Exonic
1033683758 7:143620855-143620877 TCGGAGGCGGGACTGTCCTGGGG - Intergenic
1033700854 7:143836783-143836805 TCGGAGGCGGGACTGTCCTGGGG + Intergenic
1034489297 7:151384842-151384864 TGGGAGACTGGACTGCTGGGAGG - Intronic
1049164602 8:141118171-141118193 TAGGTGCCGGGACTGACCGGTGG - Intronic
1049396587 8:142403676-142403698 TGGGAGTCCGGAGTCCCCGCGGG - Intergenic
1049411557 8:142475909-142475931 TGGGAGTGGGGCCTAGCCGGGGG + Intronic
1049436272 8:142587560-142587582 AGGGAGTGGGGACTGCAGGGTGG + Intergenic
1049436291 8:142587609-142587631 AGGGAGTGGGGACTGCAGGGTGG + Intergenic
1049585468 8:143430705-143430727 TGGGAGGCGGGGCCGGCCGGCGG - Intergenic
1055069009 9:72147800-72147822 TGGCTGTCGGTACTGCCAGGAGG + Intronic
1055640716 9:78316762-78316784 TGGGAGTCAGGACTGGGAGGGGG + Intronic
1057199848 9:93134153-93134175 GGGGAGCCGGGTGTGCCCGGAGG + Exonic
1057689544 9:97271425-97271447 GGGGAGCCGGGGCTGCCCGCGGG - Intergenic
1061037651 9:128122502-128122524 TGGGAGTGGGGGCTCCCCTGAGG - Intronic
1061078593 9:128356464-128356486 TAAGAGTCGGGACTGTCCCGGGG + Intronic
1061509591 9:131052554-131052576 AGGGAGTGGGGAGTCCCCGGGGG - Exonic
1062008305 9:134252771-134252793 TGGGCCTGGGGACTGCCCAGGGG + Intergenic
1062084929 9:134643548-134643570 TGGGTGTGGGGGCTGCCCTGGGG + Intronic
1062246023 9:135566563-135566585 TGGGAGTCTGGTCTTCCTGGAGG - Exonic
1186509616 X:10121003-10121025 TGGAAGTAGGAACTGCCAGGAGG - Intronic
1193086341 X:77450333-77450355 TTGGAGTCGGGACTGCTCTTGGG - Intronic
1194346360 X:92771498-92771520 TAGGAGTGGGGACTGGACGGGGG + Intergenic
1199041492 X:143119797-143119819 TGGGGGTGGGGACAGCCCTGGGG + Intergenic