ID: 968815594

View in Genome Browser
Species Human (GRCh38)
Location 4:2820084-2820106
Sequence GTCCTCCAGCATCTGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968815587_968815594 24 Left 968815587 4:2820037-2820059 CCACTGCTGACAACAGTGTGCTG 0: 1
1: 0
2: 1
3: 13
4: 295
Right 968815594 4:2820084-2820106 GTCCTCCAGCATCTGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968815594 Original CRISPR GTCCTCCAGCATCTGAGGCT TGG Intronic
No off target data available for this crispr