ID: 968820251

View in Genome Browser
Species Human (GRCh38)
Location 4:2844255-2844277
Sequence GGGATAGGACCCCGGGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968820243_968820251 9 Left 968820243 4:2844223-2844245 CCGGGGAGCGAGGGCGCCGCAGA 0: 1
1: 0
2: 0
3: 15
4: 131
Right 968820251 4:2844255-2844277 GGGATAGGACCCCGGGGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 125
968820239_968820251 20 Left 968820239 4:2844212-2844234 CCTGGGCCGAGCCGGGGAGCGAG 0: 1
1: 0
2: 3
3: 28
4: 253
Right 968820251 4:2844255-2844277 GGGATAGGACCCCGGGGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 125
968820246_968820251 -7 Left 968820246 4:2844239-2844261 CCGCAGATCTTTCATCGGGATAG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 968820251 4:2844255-2844277 GGGATAGGACCCCGGGGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 125
968820236_968820251 27 Left 968820236 4:2844205-2844227 CCTTCGGCCTGGGCCGAGCCGGG 0: 1
1: 0
2: 0
3: 26
4: 178
Right 968820251 4:2844255-2844277 GGGATAGGACCCCGGGGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 125
968820242_968820251 14 Left 968820242 4:2844218-2844240 CCGAGCCGGGGAGCGAGGGCGCC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 968820251 4:2844255-2844277 GGGATAGGACCCCGGGGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968820251 Original CRISPR GGGATAGGACCCCGGGGACT AGG Intronic