ID: 968829490

View in Genome Browser
Species Human (GRCh38)
Location 4:2925453-2925475
Sequence TAGGATCCTGGATATAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968829490_968829493 -1 Left 968829490 4:2925453-2925475 CCTTTTCTATATCCAGGATCCTA 0: 1
1: 0
2: 1
3: 42
4: 327
Right 968829493 4:2925475-2925497 AGTTCCTGCATTTTTTCCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968829490 Original CRISPR TAGGATCCTGGATATAGAAA AGG (reversed) Intronic
900737107 1:4305893-4305915 TTGGATCCTTGCTATGGAAAGGG + Intergenic
907027609 1:51136825-51136847 TACCATTCTGGACATAGAAATGG + Intronic
907963901 1:59310568-59310590 CAGGACCCTGGAGACAGAAAGGG - Intronic
908305142 1:62806620-62806642 TAGGATTGGGGATATAGGAAAGG + Intronic
908664207 1:66471966-66471988 TACCATCCTGGACATAGGAACGG - Intergenic
908819822 1:68073958-68073980 TACCATCCTGGACATAAAAAAGG - Intergenic
909021995 1:70441718-70441740 TAAGAGACTGAATATAGAAATGG - Intergenic
909369054 1:74862561-74862583 TACCATCCTGGCTATAGGAATGG - Intergenic
910509917 1:87992158-87992180 GAGCATCTTGGATTTAGAAAGGG - Intergenic
911441950 1:97938091-97938113 TTGGAAACTGGATGTAGAAAGGG - Intergenic
911892153 1:103385104-103385126 TACCATCTTGGACATAGAAATGG - Intergenic
912279635 1:108299326-108299348 TACCATTCTGGATATAGGAAAGG - Intergenic
912288591 1:108395031-108395053 TACCATTCTGGATATAGGAAAGG + Intronic
912647662 1:111410183-111410205 TATCATCCTGGACATAGGAACGG + Intergenic
912774970 1:112500995-112501017 TAGGATCCTGGAAAAGGAAGAGG - Intronic
912853193 1:113144868-113144890 TAGGAATCTGAATATTGAAAGGG + Intergenic
912885009 1:113461641-113461663 TACCATCCTGGACATAGAACCGG + Intronic
913459353 1:119067590-119067612 TAGGCTCCTTGATATTGAGAAGG - Intronic
914414218 1:147463831-147463853 TAATATCCTGGACATAGGAATGG - Intergenic
916568308 1:166002564-166002586 TATGATCCTGGACATAGGCATGG - Intergenic
917898763 1:179519460-179519482 TACCATTCTGGACATAGAAACGG - Intronic
918999985 1:191818311-191818333 CATGATCATGGAGATAGAAAAGG + Intergenic
919128097 1:193421193-193421215 TAGTAGCATGGAAATAGAAATGG + Intergenic
919965025 1:202514501-202514523 TACCATCCTGGACATAGAAATGG - Intronic
920728352 1:208459091-208459113 TGGAGTCCTTGATATAGAAATGG - Intergenic
921462170 1:215442426-215442448 TATGATTCTGGACATAGAAATGG - Intergenic
921623066 1:217347695-217347717 AAAGATCCTTAATATAGAAATGG - Intergenic
923365336 1:233254972-233254994 TAGGAGACTGAATATACAAATGG + Intronic
1064845675 10:19649799-19649821 TACCATCCTGGACATAGGAATGG - Intronic
1065059755 10:21887804-21887826 TAGCAACCTGGATGTAGGAATGG + Intronic
1065578091 10:27143951-27143973 TAGGATCTTGGATATAAAATAGG - Intronic
1067274374 10:44820987-44821009 TTGGATCCTGGATCAGGAAAGGG + Intergenic
1067309211 10:45096353-45096375 TAGGATCAGGGATGAAGAAAAGG + Intergenic
1069320851 10:67169697-67169719 TACCATCCTGGACATAGGAATGG + Intronic
1069805462 10:71120332-71120354 TACCATTCTGGACATAGAAATGG - Intergenic
1070620276 10:78004322-78004344 AAGGATGCTGAAAATAGAAAAGG + Intronic
1073084648 10:100880315-100880337 TAGGTTCCTGGATGTGCAAAGGG - Intergenic
1073141107 10:101248545-101248567 TTGGATCCTGGAATAAGAAAAGG - Intergenic
1074239777 10:111626343-111626365 TACCATCCTGAACATAGAAATGG + Intergenic
1075332991 10:121587325-121587347 TACCATCCTGGACATAGGAATGG + Intronic
1076862868 10:133149650-133149672 TACCATCCTGGACATAGGAACGG + Intergenic
1077984395 11:7336413-7336435 TACCATTCTGGACATAGAAATGG - Intronic
1079008379 11:16808969-16808991 TGGGTTCCTGGTTATAAAAAAGG + Intronic
1079285531 11:19127523-19127545 TACCATCCTGGATATAGGAATGG - Intronic
1079348488 11:19673208-19673230 TAGCATCCTGGTTCTATAAATGG - Intronic
1079653057 11:22955031-22955053 TAAGAACTTTGATATAGAAAGGG - Intergenic
1080026333 11:27619287-27619309 TAGGATTCTTGATGTAGAAATGG - Intergenic
1080150181 11:29043488-29043510 TACCATCCTGGACATAGAAAAGG + Intergenic
1080500669 11:32867889-32867911 TACCATCCTGGACATAGGAATGG + Intergenic
1083563758 11:63695828-63695850 TAGGATCTTGGGAAGAGAAAAGG + Intronic
1086143979 11:83530345-83530367 TATGATTCTAGAAATAGAAAGGG + Intronic
1086642103 11:89171820-89171842 AAGGATTCATGATATAGAAAGGG + Intergenic
1086761630 11:90638343-90638365 TAGTATCTTTGATACAGAAAAGG - Intergenic
1086785153 11:90959652-90959674 TACCATTCTGGACATAGAAATGG + Intergenic
1087463358 11:98472809-98472831 TAGCATCATGGATGCAGAAAAGG + Intergenic
1087532050 11:99395615-99395637 TACCATCCTGGACATAGGAATGG - Intronic
1087620213 11:100532188-100532210 TACCATCCTGGATATAGGAACGG + Intergenic
1087848733 11:103003740-103003762 TACCATCCTGGACATAGGAATGG + Intergenic
1087958995 11:104324747-104324769 TACCATCCTGGACATAGGAATGG + Intergenic
1089415658 11:118287944-118287966 TAGGAACCTGTCTATAGAACCGG + Intergenic
1090091963 11:123705855-123705877 TAGAATCCTGGATTTGGAAGGGG - Intergenic
1090162155 11:124506946-124506968 TACCATCCTGGACATAGGAATGG - Intergenic
1090741312 11:129663511-129663533 TATCATTCTGGATATAGAAATGG + Intergenic
1091968730 12:4767441-4767463 TAGGCTTATGGATAGAGAAAAGG + Intronic
1092141464 12:6186549-6186571 TGAGATCCTGGGTATGGAAAAGG + Intergenic
1093097721 12:14990832-14990854 TACCATCCTGGACATAGGAATGG + Intergenic
1093110808 12:15149768-15149790 ATGGATACTGGATTTAGAAATGG + Intronic
1093492774 12:19724304-19724326 TACCATCCTGGACATAGGAACGG + Intergenic
1093544003 12:20323224-20323246 TATGTTCCTGGAAATAGAATTGG + Intergenic
1093611223 12:21160581-21160603 TATCATCCTGGACATAGGAATGG + Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094391511 12:29956227-29956249 TAGGATCCTGCATAAGCAAAGGG + Intergenic
1095339046 12:41066267-41066289 TAGGAACCTGGACAAAGAAAGGG - Intronic
1096476557 12:51912563-51912585 CAGGAACCTGGATACAGAAAGGG + Intronic
1097002158 12:55886102-55886124 AAGAATCATGGATTTAGAAATGG + Intergenic
1097970482 12:65627941-65627963 GAGCATCTTGGACATAGAAAAGG + Intergenic
1098555074 12:71809251-71809273 TAGGATGCTGGTGATAGAAGTGG + Intergenic
1098910036 12:76199450-76199472 TAGGAGCCTGATTAAAGAAAAGG - Intergenic
1099057875 12:77868188-77868210 TATGTTCCTGTATATAAAAATGG + Intronic
1099405320 12:82252905-82252927 TAGGATTCTGCATATAAGAAAGG + Intronic
1099920731 12:88953974-88953996 TTGGATGCTGGCTTTAGAAAAGG - Intergenic
1101895858 12:108756068-108756090 TAAGGTCCTGGCTATACAAATGG + Intergenic
1102590174 12:113950835-113950857 GAGGTGCCTGGATATAGGAAAGG - Intronic
1103481862 12:121255568-121255590 TCAGATCCTGGAAGTAGAAACGG + Exonic
1104262004 12:127193271-127193293 CAGGATCCTGAATACAGAGATGG - Intergenic
1104435813 12:128755576-128755598 AAGGAGCGTGGATACAGAAAGGG + Intergenic
1105776101 13:23662109-23662131 TACCATCCTGGACATAGGAATGG - Intronic
1106298749 13:28442853-28442875 TAGGACCATAGATATAGAAGAGG + Intronic
1107189050 13:37557813-37557835 TACCATCCTGGACATAGGAATGG + Intergenic
1107379835 13:39845175-39845197 TATGATCCTGGAGACAGAGAGGG + Intergenic
1107864050 13:44686346-44686368 GGGGATCCTGGATATACAATAGG - Intergenic
1107950136 13:45454032-45454054 AAGGAGCCTGGATACAGAGAGGG - Intergenic
1111049099 13:82855799-82855821 TAGTGTTCTGGATAGAGAAAAGG - Intergenic
1111755669 13:92392470-92392492 TACCATCCTGGACATAGGAATGG + Intronic
1112837178 13:103530382-103530404 TAGAATCCTGGATCCAGAAGTGG + Intergenic
1112939629 13:104845469-104845491 TTGGATCCTGGACAAATAAAGGG - Intergenic
1113394631 13:109935431-109935453 TGCCATCCTGGATATAGGAATGG - Intergenic
1114279198 14:21175425-21175447 TACCATTCTGGATATAGGAATGG + Intergenic
1114374417 14:22128826-22128848 TACCATTCTGGACATAGAAATGG - Intergenic
1115281732 14:31670546-31670568 TACCATCCTGGACATAGGAATGG - Intronic
1115283338 14:31689734-31689756 TACCATCCTGGACATAGGAATGG - Intronic
1115293966 14:31804852-31804874 TACCATCCTGGACATAGGAATGG + Intronic
1116224053 14:42125343-42125365 TAGCATTCTGGGCATAGAAATGG + Intergenic
1117100924 14:52346241-52346263 TAGTATCCAGAATATATAAAGGG + Intergenic
1117443794 14:55783850-55783872 TACCATCCTGGACATAGGAATGG + Intergenic
1118325997 14:64781141-64781163 TATCATCCTGGACATAGGAATGG + Intronic
1118495616 14:66305514-66305536 AAGGATATTGGATATTGAAAGGG + Intergenic
1119094898 14:71820817-71820839 TACCATTCTGGATATAGATATGG - Intergenic
1120689407 14:87576128-87576150 TAAAATCCTGGAAATAGAAAAGG - Intergenic
1124992994 15:34694136-34694158 TACCATCATGGACATAGAAACGG + Intergenic
1125046860 15:35251585-35251607 TAGGATCTTGGATGTGGCAAGGG - Intronic
1125331796 15:38589786-38589808 TAGGAACCAGGAAACAGAAAAGG - Intergenic
1125400070 15:39292842-39292864 TACCATTCTGGATATAGGAATGG - Intergenic
1128476574 15:68001952-68001974 TAGGAAACTGGATAAATAAATGG + Intergenic
1128838970 15:70834225-70834247 TAGGAGCCTGTGTATAGTAATGG - Intronic
1129618959 15:77125600-77125622 AAAGACACTGGATATAGAAAAGG + Intronic
1131753392 15:95534448-95534470 TAGGTTCCTTGAAATAAAAATGG + Intergenic
1135625532 16:23991603-23991625 TTGGGTCCTTGAAATAGAAAAGG + Intronic
1136032633 16:27514636-27514658 CAGCATCCAGGATATAGTAATGG - Intronic
1138082311 16:54102220-54102242 TAGCATCCTGGACATAGGAATGG + Intronic
1139162071 16:64522030-64522052 TACCATTCTGGATATAGGAACGG + Intergenic
1140913611 16:79475416-79475438 TAAGATCCTGGACATAGACCTGG - Intergenic
1141284645 16:82660239-82660261 TAGGAACCTGGAGATAAATATGG + Intronic
1141802198 16:86317664-86317686 TAGGCTCCGGGATGGAGAAAGGG - Intergenic
1145277960 17:21446797-21446819 TACCATCCTGGACATAGAAACGG - Intergenic
1145315784 17:21732668-21732690 TACCATCCTGGACATAGAAATGG - Intergenic
1145714212 17:27004598-27004620 TACCGTCCTGGACATAGAAATGG - Intergenic
1147530148 17:41268791-41268813 TAAGATCCAAGATATAGGAATGG + Intergenic
1148967033 17:51444368-51444390 TACCACCCTGGATATAGGAACGG + Intergenic
1149791978 17:59486317-59486339 TAGGCTACTTAATATAGAAATGG + Intergenic
1152290356 17:79436781-79436803 TTGGATCCTGCATAGAGACAGGG - Intronic
1153048696 18:880975-880997 TGGGATCCTGGAAATGGGAATGG + Intergenic
1154402363 18:14052668-14052690 TGGGCTCCTTCATATAGAAATGG - Intergenic
1155063733 18:22251085-22251107 GATGATCCTGGAGATGGAAACGG + Intergenic
1155292450 18:24355582-24355604 TAGGATCAGGGAAAAAGAAATGG - Intronic
1157082654 18:44543349-44543371 TAGGATGTTGGATATTGAAATGG - Intergenic
1158899009 18:61944451-61944473 TAGGATTCTGAATTTAGTAATGG - Intergenic
1159006979 18:63022248-63022270 TATGCTCCTGGATTTCGAAAAGG + Intergenic
1159400146 18:67920841-67920863 TACCATCCTGGACATAGAAATGG - Intergenic
1167719839 19:51171738-51171760 TAGTATCCAGCATATATAAAGGG - Intergenic
1167950753 19:53025653-53025675 TACCATCCTGGACATACAAATGG + Intergenic
925513234 2:4650946-4650968 TAATAACCTGGATATAGAACAGG + Intergenic
926538372 2:14143137-14143159 TAGGATCCTGTAATTTGAAATGG + Intergenic
926782928 2:16491848-16491870 TATCATCCTGGACATAGGAATGG + Intergenic
928142602 2:28743376-28743398 TATTATCCTGGACATAGGAATGG + Intergenic
929175530 2:38971683-38971705 TAGAATGCTGGATTTTGAAAAGG + Intronic
929283695 2:40111903-40111925 TATGATCCTGGATGCAGGAAAGG + Intronic
930770388 2:55125176-55125198 TACCATCCTGGACATAGGAATGG + Intergenic
932371560 2:71193508-71193530 TACCATCCTGGACATAGGAATGG - Intronic
932452638 2:71824150-71824172 TAGGAACATAGACATAGAAATGG + Intergenic
933821355 2:86115143-86115165 TGGGAACCTGGATATTGGAAGGG - Intronic
935803559 2:106724334-106724356 TTGGATCCTGGTTATAAATAGGG + Intergenic
937848353 2:126607032-126607054 TACCATTCTGGACATAGAAATGG + Intergenic
940674473 2:156711990-156712012 TACCATCCTGGACATAGGAATGG - Intergenic
940730845 2:157389434-157389456 TAACATCCTGTACATAGAAACGG - Intergenic
942818571 2:180082535-180082557 AACGATCCTGCACATAGAAATGG - Intergenic
942819894 2:180100462-180100484 TACCATCCTGGACATAGGAATGG - Intergenic
942879742 2:180844860-180844882 TGGGATCCAGGACATAGGAAGGG + Intergenic
948043536 2:234924772-234924794 TACCATCCTAGACATAGAAATGG - Intergenic
948457170 2:238110285-238110307 TGGGATCCTGGGGACAGAAAAGG - Intronic
948845195 2:240679786-240679808 TTGGATCCAGGATATAAGAAAGG + Intronic
948848665 2:240695093-240695115 TTGGATCCAGGATATAAGAAAGG - Intronic
949054542 2:241920137-241920159 TAGCATTCTGGATATAGGGACGG + Intergenic
1169921848 20:10743038-10743060 TTGGATTCTGGATCAAGAAAAGG - Intergenic
1170514194 20:17110908-17110930 TACCATTCTGGATATAGGAATGG - Intergenic
1171748106 20:29019726-29019748 TACCATCCTGGATATAGGAAAGG + Intergenic
1171897200 20:30818768-30818790 TACCATCCTGGACATAGAAAGGG - Intergenic
1173931586 20:46824944-46824966 TACCATCCTGGACATAGGAATGG + Intergenic
1175135850 20:56823368-56823390 TGGGATCCTGGACAGAGAAAGGG + Intergenic
1176317421 21:5259956-5259978 TACCATCCTGGATATAGGAACGG - Intergenic
1177526817 21:22303762-22303784 TACAATCTTGGATATAGTAATGG + Intergenic
1180395096 22:12324379-12324401 TACCATCCTGGATATAGGAATGG - Intergenic
1180404644 22:12540372-12540394 TACCATCCTGGATATAGGAATGG + Intergenic
1181590104 22:23878849-23878871 TAGGTTTCTGGATCAAGAAAAGG - Intronic
1185042003 22:48509187-48509209 CAGGCGCCTGGATAGAGAAAAGG - Intronic
1185125753 22:49009795-49009817 CAGGATCCTGGGCATAAAAAGGG + Intergenic
950721219 3:14884044-14884066 TAGGATCAGGGATCAAGAAATGG + Intronic
951271443 3:20629562-20629584 TATCATCCTGGACATAGGAAAGG - Intergenic
951274189 3:20665108-20665130 TACCATCCTGGACATAGGAAAGG - Intergenic
951908611 3:27727583-27727605 TAAGAACCTTGAGATAGAAAAGG - Intergenic
952998978 3:38913569-38913591 TACCATTCTGGACATAGAAATGG - Intronic
953113552 3:39968146-39968168 TACCATCCTGGACATAGGAATGG - Intronic
953293587 3:41690666-41690688 TAGAACCCTGGATGAAGAAAGGG - Intronic
953832538 3:46312730-46312752 TAGGAACCTGGAAATACAACAGG - Intergenic
954722083 3:52573230-52573252 TGAGATCCTGGATATAAAACTGG + Intronic
955442212 3:58968781-58968803 TATTATCCTGGATATAGGAACGG - Intronic
955474543 3:59322410-59322432 AAGCATTCTGGATATAGAAGCGG + Intergenic
955636087 3:61030961-61030983 ATGGATCCTGGGTATGGAAAGGG + Intronic
957227661 3:77470522-77470544 TAGCGTCATGGATATAGAATAGG - Intronic
957495713 3:80988873-80988895 TACCATCCTGGAGATAGTAATGG + Intergenic
958025638 3:88045728-88045750 TAGGATCCGGGATACAGAAAAGG + Intergenic
962997078 3:140640808-140640830 TATCATCCTGGACATAGGAATGG - Intergenic
963264356 3:143225916-143225938 TAAGAACCTAGAAATAGAAAGGG + Intergenic
963338464 3:144004352-144004374 TAGGATAATGGATATTAAAAAGG + Intronic
964365541 3:155947164-155947186 TAATATACTGGATTTAGAAAAGG + Intergenic
965020743 3:163227037-163227059 CATGATCATGGAAATAGAAATGG + Intergenic
965413423 3:168361849-168361871 TAAGATCAAAGATATAGAAAGGG - Intergenic
966000112 3:174939081-174939103 TACCATCCTGGATATAGGAATGG - Intronic
966195403 3:177308933-177308955 TAAGGTTCTGTATATAGAAAAGG + Intergenic
966341707 3:178932222-178932244 TACCATCCTGGACATAGGAATGG + Intergenic
966453605 3:180090760-180090782 TACTATCCTTGACATAGAAACGG - Intergenic
966965946 3:184993980-184994002 TAGGATCCAGTTTATGGAAAAGG + Exonic
968829490 4:2925453-2925475 TAGGATCCTGGATATAGAAAAGG - Intronic
970263247 4:14252079-14252101 TTGGATCAAGTATATAGAAAAGG + Intergenic
971706473 4:30049511-30049533 TACCATCCTGGACATAGGAACGG + Intergenic
973330839 4:48908789-48908811 TAGCATCTTGGATATAGAAGGGG + Intergenic
974003677 4:56535050-56535072 TAGGCACCTGGATAAATAAATGG - Intronic
974032153 4:56785987-56786009 TACCATCCTGGACACAGAAATGG - Intergenic
975908175 4:79240430-79240452 TTGTATTCTGGCTATAGAAAAGG - Intronic
976237518 4:82914884-82914906 TACCATCCTGGACATAGGAACGG - Intronic
976832011 4:89326133-89326155 TAGGAAGGTTGATATAGAAAGGG + Intergenic
977576494 4:98679988-98680010 CAGGATCATGCAAATAGAAAGGG + Intergenic
977649127 4:99449325-99449347 TACCATCCTGGACATAGGAACGG - Intergenic
977850466 4:101821523-101821545 TACCATCCTAGACATAGAAATGG - Intronic
978049092 4:104172961-104172983 TACCATCCTGGACATAGGAACGG + Intergenic
978614311 4:110578769-110578791 TATCATCCTGGACATAGGAACGG - Intergenic
979591578 4:122486997-122487019 TATCATTCTGGACATAGAAATGG - Intergenic
979861437 4:125698227-125698249 TACCATCCTGGACATAGAAACGG + Intergenic
979988825 4:127349657-127349679 TACTATCCTGGATATAGGATTGG + Intergenic
980141033 4:128917481-128917503 CAGCATCCTGGAAATTGAAATGG - Intronic
980454984 4:133027800-133027822 TAGTAGACTGGATAAAGAAATGG + Intergenic
980573630 4:134657369-134657391 TACCATTCTGGATATAGGAATGG - Intergenic
982971583 4:161994958-161994980 TACAATCCTGGATGTAGGAATGG - Intronic
983126557 4:163959732-163959754 TACCATCCTGGACATAGGAATGG + Intronic
983701905 4:170607265-170607287 TAGGATCTTTGAAATAGAAAGGG + Intergenic
984038074 4:174693231-174693253 TACAATCCTGGACATAAAAATGG - Intronic
985305064 4:188530448-188530470 TACCATCCTGGACATAGGAACGG + Intergenic
985623715 5:972019-972041 TACCATCCTGGACATAGGAAAGG + Intergenic
986524977 5:8664087-8664109 TAGGATCCTGTATGTTGGAATGG + Intergenic
986944181 5:12994944-12994966 CAGGATCCAAAATATAGAAAGGG - Intergenic
988027508 5:25716314-25716336 TATGTTCCTGTAAATAGAAATGG + Intergenic
988123992 5:27005286-27005308 TACCATCCTGGACATAGGAAGGG + Intronic
988177083 5:27742658-27742680 TATGAGCCTGGATAAAAAAATGG - Intergenic
988976205 5:36518535-36518557 TATCATTCTGGACATAGAAATGG + Intergenic
989312075 5:40031374-40031396 AAGGAACCTGGAATTAGAAATGG + Intergenic
989559398 5:42833932-42833954 TATCATTCTGGAAATAGAAATGG + Intronic
992683449 5:79176271-79176293 TGGGATGCTGGATATAAACAAGG - Intronic
992976144 5:82122429-82122451 TACCATCCTGGACATAGGAATGG + Intronic
993894773 5:93521286-93521308 TACCATCCTGGACATAGGAAAGG + Intergenic
994399949 5:99266093-99266115 TACTATCCTGGACATAGGAAAGG - Intergenic
994514474 5:100753321-100753343 TAGAATAATAGATATAGAAATGG - Intergenic
994743373 5:103648497-103648519 AATGATCCTGGTTAGAGAAATGG + Intergenic
995008035 5:107225363-107225385 TACCATCCTGGACATAGGAACGG - Intergenic
995946695 5:117656236-117656258 TAGGATCCTGGAGCAAAAAAAGG + Intergenic
996081048 5:119258350-119258372 TACCATCCTGGATATAGGAATGG + Intergenic
996538949 5:124608789-124608811 TAGGAGCCAGGAAAGAGAAAGGG + Intergenic
997099802 5:130956827-130956849 TACCATCCTGGACATAGGAATGG - Intergenic
999352264 5:150884989-150885011 TACCATCCTGGATATAGGAATGG - Intronic
1000165557 5:158644907-158644929 TACCATCCTGGACATAGGAAAGG + Intergenic
1005229908 6:23687772-23687794 TATGATGCAGTATATAGAAATGG - Intergenic
1007252585 6:40505977-40505999 CAGGATCCTGAATATTGAGATGG - Intronic
1007545781 6:42693150-42693172 TAGGAGCCTGGAGTTAGCAAAGG + Exonic
1008203142 6:48617609-48617631 TACAATCCTGGACATAGGAATGG - Intergenic
1009443101 6:63705793-63705815 TAGGTCCCTGTATATAGAAGAGG + Intronic
1009869527 6:69436014-69436036 TGTGATCCTGGAAATAGCAATGG - Intergenic
1010333218 6:74648490-74648512 TACCATCCTGGACATAGGAATGG + Intergenic
1010685405 6:78848742-78848764 TACCATCCTGGACATAGGAATGG - Intergenic
1011096965 6:83676896-83676918 TAGGATTCTGGATATTCCAAAGG + Intronic
1011392752 6:86872544-86872566 TACTATTCTGGATATAGGAATGG + Intergenic
1011716881 6:90115587-90115609 TACCATCCTGGACATAGGAACGG + Intronic
1012403471 6:98866095-98866117 AAGGGTGCTGGGTATAGAAAAGG - Intergenic
1013314910 6:108932311-108932333 TACTATCCTGGACATAGGAACGG - Intronic
1014613831 6:123578206-123578228 TATCATCCTGGACATAGGAATGG - Intronic
1015198122 6:130546500-130546522 TACCATCCTGGACATAGGAAAGG + Intergenic
1016095173 6:140028207-140028229 TATCATCCTGGACATAGGAATGG - Intergenic
1016216449 6:141609161-141609183 TAGGATCCAGAAAATGGAAAAGG - Intergenic
1016228776 6:141775640-141775662 TACCATCCTGGACATAGGAATGG + Intergenic
1016569691 6:145498041-145498063 TGGGATCCTGTTTAAAGAAATGG + Intergenic
1016666062 6:146641822-146641844 TACCATCCTGGACATAGAAATGG + Intronic
1020331613 7:7023065-7023087 TACCATCCTGGATCTGGAAATGG - Intergenic
1020808696 7:12824346-12824368 TACCATCCTGGACATAGGAACGG + Intergenic
1020860629 7:13488504-13488526 TACCATCCTGGACATAGAAACGG + Intergenic
1020978173 7:15033615-15033637 TAGGATGATGTATATACAAAGGG - Intergenic
1020988866 7:15170754-15170776 TAGGATCCTGGAACAGGAAAAGG - Intergenic
1021088868 7:16457188-16457210 TACCATCCTGGACATAGCAACGG - Intergenic
1021805581 7:24351325-24351347 TAAGCTCCTGGAAATGGAAATGG + Intergenic
1022585802 7:31608852-31608874 TATTATCCTGGAAATAGAAGAGG + Intronic
1023555077 7:41413490-41413512 TACCATCCTGGATATAAGAATGG - Intergenic
1024165872 7:46729599-46729621 TACCATCCTGTACATAGAAATGG + Intronic
1024852101 7:53730807-53730829 TACCATCCTGGACATAGGAATGG - Intergenic
1024986338 7:55196593-55196615 TACCATTCTGGATATAGGAATGG - Intronic
1026579276 7:71600358-71600380 TAGGAAACTGGATATTGAACTGG + Intronic
1026681733 7:72472165-72472187 CAGGAACATGGATATTGAAAAGG + Intergenic
1027736145 7:81935472-81935494 TAGGATCTTGGTAAAAGAAAAGG + Intergenic
1027837302 7:83261600-83261622 TAGGATCCTGAAAAGATAAATGG + Intergenic
1028176513 7:87666562-87666584 TACCATCCTGGACATAGGAATGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028878776 7:95855348-95855370 GAGGATTCTGAAGATAGAAAGGG - Intronic
1029052893 7:97708179-97708201 TACCATCCTGGACATAGGAATGG + Intergenic
1030133951 7:106228422-106228444 TAACATCCTGGACATTGAAATGG - Intergenic
1031319848 7:120311140-120311162 CAGGAACCTAAATATAGAAAAGG - Intronic
1033971040 7:147039873-147039895 TACCATCCTGGACATAGGAATGG + Intronic
1037012324 8:13859016-13859038 TAAGATACTGGTTATAGATAAGG + Intergenic
1037147747 8:15593743-15593765 AAGGATCTTGGATGTAGAAAGGG - Intronic
1037285611 8:17295341-17295363 TACCATCCTTGATAAAGAAATGG - Exonic
1041207221 8:55511241-55511263 AAGGATCTTGAATATAGAATTGG - Intronic
1041523258 8:58777488-58777510 TATCATCCTGGACATAGGAATGG + Intergenic
1041611818 8:59859094-59859116 TACCATCCTGGACATAGGAATGG + Intergenic
1042046228 8:64655088-64655110 TACCATCCTGGACATAGGAATGG + Intronic
1042555201 8:70028522-70028544 TAGTATCCTGGCTATAGCTATGG + Intergenic
1043507365 8:80915742-80915764 GAGGATTCTGGATACAGAATGGG - Intergenic
1043861868 8:85327213-85327235 TAGAATTCTGGATGTAGATATGG + Intergenic
1044214095 8:89586937-89586959 TACCATCCTGGATGTAGGAATGG - Intergenic
1044959928 8:97520380-97520402 TACCATCCTGGACATAGGAACGG + Intergenic
1046156997 8:110305066-110305088 TACCATCCTGGACATAGGAACGG + Intergenic
1046333232 8:112749414-112749436 TACCATCCTGGACATAGGAACGG - Intronic
1046589124 8:116184359-116184381 TTGCATCCTGGATAGGGAAAAGG - Intergenic
1046958613 8:120086588-120086610 TAGGATCCTGGAACTAAAAAAGG - Intronic
1047865111 8:129014897-129014919 TACGATTCTGGACATAGGAATGG - Intergenic
1050891129 9:10825868-10825890 TACCATCCTGGACATAGGAACGG - Intergenic
1051089702 9:13391976-13391998 TACCATCCTGGACATAGGAATGG + Intergenic
1052195323 9:25706152-25706174 TTGGATCCTGGATCAGGAAAAGG + Intergenic
1052394835 9:27926511-27926533 TGAGATGCTGGATAGAGAAAAGG - Intergenic
1052767387 9:32655451-32655473 TACTATCCTGGACATAGGAATGG + Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1053542565 9:38989798-38989820 TATCATCCTGGACATAGGAATGG - Intergenic
1053807020 9:41813315-41813337 TATCATCCTGGACATAGGAATGG - Intergenic
1054623572 9:67374112-67374134 TATCATCCTGGACATAGGAATGG + Intergenic
1055624051 9:78154825-78154847 TATTATCCTGGACATAGGAATGG + Intergenic
1056330795 9:85519585-85519607 TAGGATCCTACATACAGCAAAGG + Intergenic
1057171882 9:92967919-92967941 TAGAAACCTGGATAAAGAAAAGG - Intronic
1057246651 9:93461108-93461130 TAGGATCTGTGATTTAGAAACGG + Intronic
1057696649 9:97327767-97327789 TAGGACCCTGGACAGGGAAAGGG + Intronic
1058234468 9:102471964-102471986 TAGTATCAAGGATATATAAAAGG - Intergenic
1058578445 9:106428754-106428776 TGGGAACCTGGATAAAGAGAAGG + Intergenic
1059391744 9:114003619-114003641 TAAGATTCTGCATAGAGAAAGGG + Intronic
1059912658 9:119063357-119063379 TACTATCCTGGACATAGAAATGG - Intergenic
1060336993 9:122734190-122734212 TACCATTCTGGATATAGGAATGG + Intergenic
1060572820 9:124658564-124658586 TAGGATTCTTGCTGTAGAAATGG - Intronic
1060835295 9:126751196-126751218 TAGGATCTTGGATCTAGTGAGGG - Intergenic
1061616459 9:131783166-131783188 TACCATCCTGGACATAGGAATGG - Intergenic
1203410301 Un_KI270581v1:2283-2305 TACCATCCTGGATATAGGAATGG + Intergenic
1203415683 Un_KI270582v1:5004-5026 TACCATCCTGGATATAGGAACGG - Intergenic
1186119467 X:6343771-6343793 TAGGATGATGGATATTGATATGG + Intergenic
1187228029 X:17392952-17392974 TAGAAATCTAGATATAGAAAAGG - Intronic
1188134375 X:26476411-26476433 TAGCATGCTGGACATAGGAATGG + Intergenic
1188635527 X:32426046-32426068 TACCATCCTGGACATAGGAATGG + Intronic
1188810496 X:34648617-34648639 TACCATCCTGGACATAGGAACGG + Intronic
1188982700 X:36741537-36741559 TACCATCCTGGACATAGGAATGG - Intergenic
1189771839 X:44434877-44434899 CACCATCCTGGATATAGGAATGG + Intergenic
1190589416 X:51983990-51984012 TACCATCCTGGACATAGGAAAGG - Intergenic
1190912018 X:54781159-54781181 TAGCATTCTGGACATAGGAAAGG + Intronic
1191021400 X:55864739-55864761 TACCATCCTGGACATAGCAACGG + Intergenic
1191610987 X:63113194-63113216 TACCATTCTGGATAAAGAAATGG + Intergenic
1192303366 X:69930291-69930313 TAGGCCTCTGAATATAGAAATGG + Intronic
1193006350 X:76622934-76622956 TACCATCCTGGATATAGGAAAGG + Intergenic
1193093045 X:77514676-77514698 TATAATTCTGGATATAGGAATGG + Intronic
1193285408 X:79708431-79708453 TACCATCCTGGACATAGAACTGG + Intergenic
1193703835 X:84795755-84795777 TACCATTCTGGATATAGGAATGG + Intergenic
1193704503 X:84804850-84804872 TACCATCCTGGACATAGGAATGG - Intergenic
1193805560 X:85989416-85989438 TACCATCCTGGACATAGGAATGG + Intronic
1193820976 X:86164507-86164529 TACCATCCTGGACATAGGAACGG - Intronic
1193883335 X:86954399-86954421 TACCATCCTGGACATAGGAACGG - Intergenic
1194105938 X:89767399-89767421 TAGGATCTTGGAACCAGAAAGGG - Intergenic
1194347038 X:92778453-92778475 TACCATTCTGGATACAGAAATGG + Intergenic
1194525608 X:94973312-94973334 TAGCATTCTGGACACAGAAATGG - Intergenic
1194910590 X:99638324-99638346 TAGGATCCTGAATACATTAAAGG + Intergenic
1195202190 X:102562819-102562841 TAGCATCCTGAATAAAGAAATGG - Intergenic
1195275965 X:103281028-103281050 CACCATCCTGGACATAGAAATGG - Intergenic
1196142958 X:112285497-112285519 GAGGATGCTGGATTTAGAAAAGG - Intergenic
1197023939 X:121724235-121724257 TACCATCCTGGACATAGGAATGG + Intergenic
1198806050 X:140495819-140495841 TAGGATCCTGGAAAAGAAAAAGG - Intergenic
1199183266 X:144883622-144883644 TACAATCCTGGACATAGGAATGG + Intergenic
1199365604 X:146978520-146978542 TACCATCCTGGACATAGGAATGG - Intergenic
1199469211 X:148175471-148175493 TACTATCCTGGACATAGCAACGG - Intergenic
1199492767 X:148419157-148419179 TACCATCCTGGACATAGGAATGG + Intergenic
1200457894 Y:3415258-3415280 TAGGATCTTGGAACCAGAAAGGG - Intergenic
1200655366 Y:5895091-5895113 TACCATTCTGGATACAGAAATGG + Intergenic
1201395720 Y:13545670-13545692 TAGCATTCTGGAGATAGGAATGG + Intergenic
1202300657 Y:23410322-23410344 TACCATCCTGGACATAGAAATGG - Intergenic
1202570154 Y:26260276-26260298 TACCATCCTGGACATAGAAATGG + Intergenic