ID: 968829559

View in Genome Browser
Species Human (GRCh38)
Location 4:2925908-2925930
Sequence TTCTCAGAGGGCGGCCGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968829549_968829559 21 Left 968829549 4:2925864-2925886 CCTCTCTTGGAGAGGATCAGGGA 0: 1
1: 0
2: 2
3: 13
4: 180
Right 968829559 4:2925908-2925930 TTCTCAGAGGGCGGCCGAGCGGG 0: 1
1: 0
2: 1
3: 2
4: 106
968829546_968829559 28 Left 968829546 4:2925857-2925879 CCTTTATCCTCTCTTGGAGAGGA 0: 1
1: 0
2: 0
3: 16
4: 187
Right 968829559 4:2925908-2925930 TTCTCAGAGGGCGGCCGAGCGGG 0: 1
1: 0
2: 1
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968829559 Original CRISPR TTCTCAGAGGGCGGCCGAGC GGG Intronic