ID: 968830539

View in Genome Browser
Species Human (GRCh38)
Location 4:2931226-2931248
Sequence TCCTCCGTGGTCGCTGGCTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968830539_968830546 0 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830546 4:2931249-2931271 CAGGCAGGGCACCACAACGGCGG 0: 1
1: 0
2: 0
3: 12
4: 105
968830539_968830545 -3 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830545 4:2931246-2931268 GGACAGGCAGGGCACCACAACGG 0: 1
1: 0
2: 0
3: 15
4: 194
968830539_968830553 25 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830553 4:2931274-2931296 GCTGGTGGGAGACATCGAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 198
968830539_968830547 3 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830547 4:2931252-2931274 GCAGGGCACCACAACGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 72
968830539_968830549 10 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830549 4:2931259-2931281 ACCACAACGGCGGCGGCTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 75
968830539_968830551 11 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830551 4:2931260-2931282 CCACAACGGCGGCGGCTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
968830539_968830552 22 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
968830539_968830548 7 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830548 4:2931256-2931278 GGCACCACAACGGCGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968830539 Original CRISPR TCCTCCGTGGTCGCTGGCTA TGG (reversed) Exonic
905492203 1:38353382-38353404 TCTTCCGTGGTCTCCGGCTCTGG - Intergenic
915509492 1:156378716-156378738 TCCTCCCTCCTCGCTGGCTCAGG + Intronic
923921085 1:238565238-238565260 TCCTCCCAGGTAGCTGGCCAAGG + Intergenic
924585058 1:245354680-245354702 TCTTCCGTTGTAGCTGGCAATGG - Intronic
1062843351 10:687963-687985 CCCTCCGTGTTCGCTGTCTCAGG - Intronic
1073462755 10:103676175-103676197 TCCTCCCTGGCCACTGGCCAAGG + Intronic
1076713140 10:132350051-132350073 TCCTCTGTGTTCTCTGGCCAGGG + Intronic
1078489990 11:11759653-11759675 TCCTCTGTGGCCGCTGGAGAAGG - Intergenic
1090233437 11:125127214-125127236 GCCTGTGTGGTAGCTGGCTAAGG - Intergenic
1091916163 12:4272928-4272950 TCCTGCGTGGCCGCTGGCCGCGG + Intergenic
1101165296 12:102023950-102023972 TCCTCCGTGGTAGTTACCTATGG + Intronic
1105502072 13:20981434-20981456 TCCTGCGGGGTGGCTGGCCATGG + Intronic
1121511789 14:94517966-94517988 GCCTCCGTGGCCCCTGGCTGGGG + Intergenic
1125602550 15:40923504-40923526 GCCTCCCTGCTTGCTGGCTAGGG + Intergenic
1132678189 16:1129322-1129344 ACCCCAGTGGTCCCTGGCTAGGG - Intergenic
1141516552 16:84548834-84548856 TCCTCCGTGTTGGTTGGCCAGGG + Intronic
1148695659 17:49556604-49556626 ACCTCCGTGGCCGCTGACTCCGG - Intergenic
1162100433 19:8335524-8335546 TCCACCGTCGTCACTGGCCAGGG + Exonic
930271491 2:49262758-49262780 TCCTCTGGGGAAGCTGGCTATGG - Intergenic
935046764 2:99489899-99489921 TCCTCCCTGGTCCCTGGCGAGGG - Exonic
936047766 2:109200432-109200454 TCCTGTGTGGTCCCTGGGTATGG + Intronic
948380666 2:237547892-237547914 TCCTCCTGGGGCGCTGGCCATGG - Intronic
948723050 2:239913303-239913325 TCCTCCGAGGACGCTGGCCTAGG + Intronic
1171439233 20:25147682-25147704 TCCTCCGTGGTCCCTGGATCTGG - Intergenic
1178823985 21:35999893-35999915 TCCTCCGTGGTCTCTCCCCAGGG - Intronic
1178830546 21:36053100-36053122 TCCTCCCTTGCAGCTGGCTAGGG + Intronic
1179913811 21:44463781-44463803 TCCGCCGAGGCCGCTGGCCAAGG + Intergenic
955018522 3:55095807-55095829 TCCTCCTTGGTCCATGGCTTTGG + Intergenic
956481460 3:69677592-69677614 TCCTCCGTAGCCGCTGGCCAGGG - Intergenic
968830539 4:2931226-2931248 TCCTCCGTGGTCGCTGGCTATGG - Exonic
985634882 5:1031056-1031078 GCCACCGTGGTCACTGGCCAGGG - Intronic
1005423487 6:25677048-25677070 TCCTCCCTGGTCACTCTCTATGG + Intronic
1017414739 6:154207676-154207698 TCCTCCTCTGTCGCTGGCCAAGG + Intronic
1017719645 6:157235867-157235889 TCCTCCGTGGTGGCTGCCTTGGG + Intergenic
1019161324 6:170068588-170068610 TCCTCCATGGTTCCTGGCTGTGG - Intergenic
1019537850 7:1538321-1538343 ACCTCCCTGGTCTCTGGCTGCGG + Intronic
1021963789 7:25897663-25897685 TCCTCCGTGGTCTTTGGCCCTGG - Intergenic
1033165568 7:139036010-139036032 TCCGCCATGGTCGCTGGCGCGGG + Exonic
1035545031 8:473690-473712 TCCTCAGTGAACGCTGGTTATGG - Intergenic
1037969761 8:23163756-23163778 TCCGCCGCGGTCCCTGGCTGGGG - Intronic
1041166999 8:55101421-55101443 TCCACCGAGGGCGCTGGCTCGGG + Intergenic
1041548106 8:59069290-59069312 CCCTCCGTGGATGCTGGCTGGGG + Intronic
1051524036 9:18022431-18022453 TCCTCCCTCCTAGCTGGCTATGG + Intergenic
1054769399 9:69069766-69069788 TCCTCCGTGGACTCCCGCTATGG - Intronic
1057507425 9:95647334-95647356 TCCTCCGTGGTTGCTGGTAAAGG + Intergenic
1061578759 9:131523992-131524014 TCCTGCGTGGTGGCTGTCTCTGG - Exonic