ID: 968830541

View in Genome Browser
Species Human (GRCh38)
Location 4:2931232-2931254
Sequence TGCCTGTCCTCCGTGGTCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968830541_968830548 1 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830548 4:2931256-2931278 GGCACCACAACGGCGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 79
968830541_968830546 -6 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830546 4:2931249-2931271 CAGGCAGGGCACCACAACGGCGG 0: 1
1: 0
2: 0
3: 12
4: 105
968830541_968830552 16 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
968830541_968830547 -3 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830547 4:2931252-2931274 GCAGGGCACCACAACGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 72
968830541_968830549 4 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830549 4:2931259-2931281 ACCACAACGGCGGCGGCTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 75
968830541_968830545 -9 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830545 4:2931246-2931268 GGACAGGCAGGGCACCACAACGG 0: 1
1: 0
2: 0
3: 15
4: 194
968830541_968830553 19 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830553 4:2931274-2931296 GCTGGTGGGAGACATCGAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 198
968830541_968830551 5 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830551 4:2931260-2931282 CCACAACGGCGGCGGCTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968830541 Original CRISPR TGCCTGTCCTCCGTGGTCGC TGG (reversed) Exonic
900356330 1:2266563-2266585 TGCCTGACCTCCAGGGTCCCTGG + Intronic
900652313 1:3735717-3735739 TGCCTGTCCCCCTTGGCCCCAGG - Exonic
900731944 1:4267920-4267942 TGCCCATCCTGCGTGGTCTCTGG - Intergenic
901397618 1:8992864-8992886 TGCCAGTCCTCCTGGGTGGCTGG - Intergenic
901860517 1:12071537-12071559 TGCCTGTGTTCCTTGGTCCCTGG + Intronic
902620129 1:17645971-17645993 GGCCTTTCCTCCCTGGTGGCAGG + Intronic
903261410 1:22133626-22133648 AGCCTGTACTCCGTGGTGGCAGG - Intronic
904298744 1:29540777-29540799 CCCCTGTCCTGCGTGGTTGCCGG + Intergenic
904399723 1:30248147-30248169 TGCCTGTCCTCGCTGCTCACGGG - Intergenic
905492204 1:38353388-38353410 TGCTTCTCTTCCGTGGTCTCCGG - Intergenic
912359909 1:109086677-109086699 TGCCTCTCCTCCGGAGTAGCTGG - Intergenic
912443719 1:109717472-109717494 AGGCTGTCCTCCAGGGTCGCAGG - Exonic
915631385 1:157155855-157155877 TGCCCGTCCTCCCTGGAGGCTGG - Intergenic
916826930 1:168451227-168451249 TGCCTGGCCCCTGTGGTGGCAGG - Intergenic
1064907309 10:20360780-20360802 TGCATGTCTTACGTGGTCACAGG + Intergenic
1073122619 10:101131777-101131799 TGCCGGGCCTCCGGGGCCGCCGG - Exonic
1074408213 10:113199519-113199541 TGCCTGTGGTCCCTGGTAGCAGG + Intergenic
1077325643 11:1962880-1962902 GCCCTGGCCTCCGTGGACGCTGG + Intronic
1080386293 11:31812994-31813016 TGCCCGGGCTCCTTGGTCGCAGG - Intronic
1084398768 11:68931703-68931725 CGCCTGTCCTCCCTGCTCCCAGG - Intronic
1084435468 11:69136788-69136810 TGCCTGTCCACCAAGGTCCCAGG - Intergenic
1091230911 11:133987437-133987459 TGCCTGGCCTCCTTGGAGGCTGG - Intergenic
1202808623 11_KI270721v1_random:18059-18081 GCCCTGGCCTCCGTGGACGCTGG + Intergenic
1091395127 12:149712-149734 TCCCTGACCTCCGTTGTCCCCGG - Intronic
1092237593 12:6819717-6819739 TTCCTGCCCTCTGTGGTCCCAGG - Exonic
1093756965 12:22863306-22863328 TGCCAGTCCTCCCTGGCCACAGG - Intergenic
1098357959 12:69628944-69628966 TGCCTGCCCTCCTTGCTCACAGG - Intergenic
1102612223 12:114122334-114122356 TGCCTCTCCTCCTTGGTGGGGGG - Intergenic
1103910278 12:124348357-124348379 TGCCTGCCCACCGTGGTCCTGGG - Intronic
1105518526 13:21111648-21111670 TGCCTGGCCTCCCAGGTCCCAGG - Intergenic
1110633515 13:77737821-77737843 TGCCTGTCTTCTGTAGTAGCTGG + Intronic
1111077537 13:83257415-83257437 TCCCTGTCCTACGTGGTATCTGG - Intergenic
1119759126 14:77139308-77139330 TGCCTCTACTCCATGGTGGCCGG - Exonic
1121873082 14:97427100-97427122 TACCTGTTCTCCGGGGTCCCTGG - Intergenic
1122468130 14:101948267-101948289 TGCCTCTCCTTCCTGGCCGCTGG + Intergenic
1122621517 14:103060089-103060111 TGCCTGTCCTCTGTGTCCCCTGG + Intergenic
1124719408 15:32098516-32098538 TGCCTCTCATCTGTGGTCACAGG + Intronic
1128372402 15:67049916-67049938 TGCCTGGCCCCTGTGGTCACAGG + Intergenic
1132582245 16:690235-690257 ACCCTGTACTCCGGGGTCGCCGG - Exonic
1133810083 16:9154927-9154949 TGCCTGTCCTGCGGGGAAGCGGG - Intergenic
1136026492 16:27472152-27472174 TCCCTGTCCTTTGTGGTCTCTGG - Intronic
1137613121 16:49832322-49832344 TGCCTGTCTTCTGGGGTAGCAGG + Intronic
1140511590 16:75512615-75512637 TGCCTTACCTCAGTGGTCTCTGG + Intergenic
1141428595 16:83959280-83959302 TGCCTGTCCTACCTGCTCTCCGG + Exonic
1143116449 17:4584334-4584356 CGCCGCTCCTCCGGGGTCGCAGG + Intronic
1151502148 17:74497477-74497499 TGCCTGTCCTGCCTGCTCCCAGG - Intergenic
1152705416 17:81841131-81841153 TGCCTGTGCTCCCTGGCCGTGGG - Intergenic
1152790677 17:82277342-82277364 TGCCTGGCCTCCTGGGTAGCTGG - Intergenic
1153840211 18:9000598-9000620 TGTCTGTCTTCAGTGGTCCCAGG - Intergenic
1155991153 18:32280810-32280832 TGACTGACCCCCGTGGTAGCTGG + Intronic
1157655545 18:49384206-49384228 TGCCTGGCCTCCTGGGTAGCTGG - Intronic
1160422812 18:78759280-78759302 TGCCTGTCCTCTTGGGTCCCAGG - Intergenic
1160668174 19:343375-343397 TGGCTGTCCTCCAGGGTCGGAGG - Intronic
1160718311 19:586413-586435 TGCGTGTCATCTGTGGTCCCAGG - Intergenic
1160948870 19:1656177-1656199 TGCCCGTGCTCAGTGGACGCCGG - Intergenic
1162312352 19:9914539-9914561 TGCCAGGTCTCCGTGGTCCCTGG - Intronic
1163167383 19:15507774-15507796 TGTCTGTCCTCCGGAGTCGGTGG - Intergenic
1166711133 19:44938140-44938162 TGCCTGTAATCCCTGGTGGCAGG - Intergenic
1167094341 19:47366167-47366189 TGCCTCTCCTCCATGGTCTGGGG + Intronic
1168046978 19:53801146-53801168 AACCTGGCCTCCGTGGTCCCAGG + Intronic
925730726 2:6917946-6917968 TGCCTGCCCTGCGCGGTCGCGGG + Intronic
926723846 2:15982536-15982558 TGCCTGTCCTCCCAGGTCCCTGG - Intergenic
931628740 2:64280866-64280888 TGCCTTCCCTCCGTGGTGGCAGG + Intergenic
931628888 2:64282055-64282077 TGCCTTCCCTCCGTGGTGGCAGG - Intergenic
948365324 2:237450883-237450905 TGCCTCTCCTCCCTGGTCACTGG - Intergenic
1173464175 20:43268146-43268168 TGCCTGTCCTCTGTGGGGACAGG + Intergenic
1173860992 20:46283471-46283493 TGCCTGCCCTCCATGGAAGCTGG + Intronic
1175713603 20:61240619-61240641 TGGCTGTCCTCTGTGGGCACAGG + Intergenic
1176080834 20:63272444-63272466 TGCCGGTCCTCCATGGCCCCCGG + Intronic
1179578604 21:42323223-42323245 TGCATGTCCTCCATGGTTGGAGG - Intergenic
1179909577 21:44440911-44440933 TGCCTGGCCTCCCTGGAGGCGGG + Intronic
1183162475 22:36124099-36124121 CGCCTGTCCTCCAAGGTCCCGGG + Intergenic
1183393192 22:37557399-37557421 TGCCTGCCCTCCCTGCCCGCGGG + Intergenic
1185320419 22:50198089-50198111 TGCGTCCCCTCCGTGGTCGTGGG + Exonic
953551480 3:43906985-43907007 TGCATCTCCTCCGTGGTTTCAGG - Intergenic
961542926 3:127612227-127612249 TGCCTGCCTTCCGTGGGCCCTGG + Intronic
964444235 3:156741992-156742014 TGCCAGTCCTCCATGGCAGCGGG - Intergenic
964958635 3:162394451-162394473 TGCATGTTCTGGGTGGTCGCTGG + Intergenic
968433706 4:574814-574836 TGCCCGTCCTCCCTTGCCGCGGG + Intergenic
968816784 4:2825728-2825750 TGCCAGGCCTCCCTGGTGGCAGG - Intronic
968830541 4:2931232-2931254 TGCCTGTCCTCCGTGGTCGCTGG - Exonic
968970726 4:3792167-3792189 TGCCTGGCCTCCCTGGCAGCAGG + Intergenic
974816020 4:67004213-67004235 GGCCTGTCCTCCAAGGTCTCTGG + Intergenic
977371115 4:96137445-96137467 TGCCTCTGCTCCCTGGTAGCCGG - Intergenic
993523761 5:88938732-88938754 TGCCTGTCTTCTGTGATCACTGG - Intergenic
998315115 5:141175148-141175170 TGCCTGTGCTCTGGGGTAGCAGG - Exonic
998452275 5:142244253-142244275 TGCCTGCCTTCCATGGTGGCTGG + Intergenic
1001904066 5:175456291-175456313 TGCCTGTCCCACGTGGTCAGGGG - Intergenic
1002080327 5:176733681-176733703 TGCCTGTCCTCCCTGTTGGACGG + Intergenic
1002593561 5:180307133-180307155 TGCCTGTCCTCCGTGGGGGTGGG + Intronic
1006509606 6:34514959-34514981 TCCTTCTCCTCCGTGGTGGCGGG - Intronic
1007702805 6:43774328-43774350 TTTCTGTCCTCAGTGGTCCCAGG + Exonic
1019645146 7:2124951-2124973 TGTGTGTCCTCCGTGCTCACTGG - Intronic
1021911153 7:25386842-25386864 TGCCAGTCCTCTGTGGTGGGAGG + Intergenic
1026835539 7:73636581-73636603 TGCCTGTGCTCCGAGGGAGCTGG - Intergenic
1028829098 7:95307172-95307194 TGCCTGGCCTCCCTGGTAGCTGG + Intronic
1029623090 7:101702133-101702155 TGCCTATCCTCCGAAGTAGCTGG - Intergenic
1033372714 7:140725823-140725845 TTCCTGACCTCCGGGGTCTCTGG - Intronic
1034276047 7:149824324-149824346 TGCCTGTCCACCAGGGTCTCTGG + Intergenic
1034775722 7:153824728-153824750 TGTATGTCCTCCTTGGTGGCTGG + Intergenic
1034924845 7:155113014-155113036 TGTCTGCCCTCCTTGGGCGCTGG - Intergenic
1035277964 7:157759181-157759203 TGCCTGGGCGCCGTGGGCGCAGG + Intronic
1039455576 8:37703786-37703808 TGCCTCTCCTCGGTCGTCCCTGG + Intergenic
1045480437 8:102587245-102587267 TGCCTGTCCTACATGGTTGTTGG + Intergenic
1049510780 8:143025694-143025716 TGCCCCTCCTCTGTGGTCACTGG - Intergenic
1050244386 9:3672673-3672695 TGCCTGTCCCCCGTAATTGCTGG - Intergenic
1056455075 9:86752137-86752159 TGCCTGTCCTCTGTGGACTCTGG + Intergenic
1057022864 9:91714282-91714304 TGCCTGTCTGCTGTGCTCGCGGG - Intronic
1061989730 9:134152440-134152462 GGCCTGTCCTCCGTGCCCCCAGG - Intronic
1062225516 9:135447376-135447398 GGCCTGTCCTGCCTGGCCGCAGG + Intergenic