ID: 968830544

View in Genome Browser
Species Human (GRCh38)
Location 4:2931239-2931261
Sequence GGTGCCCTGCCTGTCCTCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 224}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968830544_968830556 30 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830556 4:2931292-2931314 GGAGGTGCCCGTCAGCCCAGGGG 0: 1
1: 0
2: 3
3: 20
4: 295
968830544_968830554 28 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830554 4:2931290-2931312 GAGGAGGTGCCCGTCAGCCCAGG 0: 1
1: 0
2: 2
3: 23
4: 350
968830544_968830551 -2 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830551 4:2931260-2931282 CCACAACGGCGGCGGCTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
968830544_968830552 9 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
968830544_968830549 -3 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830549 4:2931259-2931281 ACCACAACGGCGGCGGCTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 75
968830544_968830555 29 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830555 4:2931291-2931313 AGGAGGTGCCCGTCAGCCCAGGG 0: 1
1: 1
2: 1
3: 20
4: 241
968830544_968830547 -10 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830547 4:2931252-2931274 GCAGGGCACCACAACGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 72
968830544_968830548 -6 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830548 4:2931256-2931278 GGCACCACAACGGCGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 79
968830544_968830553 12 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830553 4:2931274-2931296 GCTGGTGGGAGACATCGAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968830544 Original CRISPR GGTGCCCTGCCTGTCCTCCG TGG (reversed) Exonic
900146305 1:1160362-1160384 GGGCCGCTGTCTGTCCTCCGTGG + Intergenic
900237021 1:1597819-1597841 GGCACCCTGCCTGTCCTGCTAGG + Intergenic
900548856 1:3243565-3243587 GGTGCAGTCCCTGCCCTCCGGGG - Intronic
900964659 1:5949636-5949658 GGTCCTCTGACTGTCCTGCGGGG - Intronic
901081612 1:6587003-6587025 GATGCCAAGCCTGTCCTCCATGG - Intronic
903066883 1:20704624-20704646 GGTGGCCTGCCTGTCGCCTGCGG - Exonic
904033987 1:27549465-27549487 AGTGCCCTGCCTGCCCAGCGGGG - Exonic
904325412 1:29724665-29724687 GAGGCCCTGCCTGTGCTCCCAGG + Intergenic
904801278 1:33094507-33094529 GGAGCCCTGCATGTCAGCCGAGG + Intronic
905345528 1:37308750-37308772 GGTGGCCTGCCTGTTCTTGGAGG - Intergenic
906062748 1:42958969-42958991 GGGGCCCAGCCTGTCCTGGGCGG + Intergenic
906208569 1:43999849-43999871 GTGGCCTTGCCTGTCCTCTGTGG + Intronic
907239908 1:53075616-53075638 CCTGCCCTGCCCGTCCTCCTGGG - Intronic
907242550 1:53088814-53088836 GGTGCCCTGCCCACCCTGCGTGG + Intronic
907318151 1:53585728-53585750 AGTGCCCTGTCTGTACTCAGAGG + Intronic
907987273 1:59544414-59544436 GGTGCCCTCCCTGTACTCAAAGG - Intronic
908218529 1:61979923-61979945 GGTGCCCTGCCTATACCCAGAGG - Intronic
910857273 1:91708001-91708023 TCTGCCCTGCCTGTCCTCTCAGG + Intronic
913552273 1:119927227-119927249 TGTGCCCTGCGTCTCCTCTGTGG - Intronic
919897033 1:202015380-202015402 TCTGGCCTGCCTGTCCTCCCAGG - Exonic
921588359 1:216974827-216974849 ACTGCCCTCCCTGTCCTCCGAGG - Intronic
923337688 1:232984643-232984665 GTTGCCCGTCCTGTCCTCAGAGG - Intronic
1062805166 10:413949-413971 GGCGCCCTGCCTGACCACCATGG - Exonic
1062839901 10:662025-662047 GGAGCCTGGCCTGTCCCCCGTGG + Intronic
1063383330 10:5600441-5600463 GGAGCCCACGCTGTCCTCCGTGG + Intergenic
1067153366 10:43754005-43754027 TGAGCCCTGACTGTCCTCCGAGG + Intergenic
1069953234 10:72034041-72034063 GGTGCTCTCTCTGTCCTCAGAGG + Intergenic
1070917571 10:80164654-80164676 GCTGCCCAGCCTGTCCTCTATGG - Intronic
1071295625 10:84217213-84217235 GGAGCTCTGCCTGTCCTACTGGG - Exonic
1072726810 10:97819384-97819406 GTTCCCCTGCCTCTCCTCCTTGG + Intergenic
1073241844 10:102064403-102064425 TGAGCCCTGCCTCTCCTCCCCGG - Intergenic
1073326703 10:102647509-102647531 GGGGCCCTGCCTGCCCTCCCAGG + Intronic
1074577519 10:114684436-114684458 GGGGCCCTGGCTCTCCTCCCAGG + Intronic
1075052549 10:119193570-119193592 GGTGCCCAGCCTGTACCCAGAGG + Intergenic
1075178015 10:120183986-120184008 GGTGCCCTGCCTGTGTCCCTGGG + Intergenic
1075463347 10:122633012-122633034 AGTGCCCTGCCAGCCCTCAGTGG + Intronic
1075709471 10:124522872-124522894 GGTGCCCTCTCTGTCCTCAGTGG + Intronic
1075722892 10:124597740-124597762 TGTGCCCTGCCTGTGCCCCTGGG + Intronic
1076221990 10:128741177-128741199 TGTGCCCTTCCTGTCCTGGGTGG - Intergenic
1076606188 10:131691452-131691474 GGTGCCCTTCCTGGCATCCTAGG - Intergenic
1076978987 11:195403-195425 GCTGCCCTGGCTGACCTCAGAGG - Intronic
1077194377 11:1272085-1272107 CGGGCCCTGCGTGTCCTCTGGGG - Intergenic
1077305437 11:1866799-1866821 GGGGCTCTGCCCCTCCTCCGGGG - Exonic
1081710945 11:45214930-45214952 CATGCCCTTCCTTTCCTCCGAGG - Intronic
1081731311 11:45373710-45373732 GGTGCTCTGTCTGTCATCCTGGG + Intergenic
1084179129 11:67437815-67437837 GCTGCCGGGCCTGTCCTCCAAGG + Exonic
1084323308 11:68385404-68385426 AGTGCCTTGCCTGTTCTCTGTGG + Intronic
1084639798 11:70418417-70418439 GGTGCTCGGCCTGTGCTCCCTGG - Intronic
1085012087 11:73148243-73148265 GGCATCCCGCCTGTCCTCCGTGG + Intergenic
1085412986 11:76302545-76302567 GGTCCCAGGCCTGCCCTCCGGGG - Intergenic
1085525416 11:77160909-77160931 GGAGCCTGGCCTGTCCCCCGGGG + Intronic
1097177522 12:57152005-57152027 GGGGCCCTGCCTGGCCTTTGGGG + Intronic
1102381258 12:112468658-112468680 GGTGCCTCTCCTGTCCTCTGTGG + Intronic
1102571522 12:113829845-113829867 TGGGCACTGCCTGTCCTCTGGGG - Intronic
1104437314 12:128766306-128766328 GGTTCCATGCCTCTCCTGCGTGG - Intergenic
1104727355 12:131086195-131086217 GCTGCCCCGCGTGTCCTGCGTGG + Intronic
1104795084 12:131511695-131511717 GGTGCCCACCCTGTCCTCCGAGG + Intergenic
1104860655 12:131921663-131921685 AGGCCCTTGCCTGTCCTCCGGGG - Exonic
1107448578 13:40489042-40489064 AGTGGCCAGACTGTCCTCCGTGG - Intergenic
1113765127 13:112876552-112876574 GGAAGCCTGCCTGTCCTCAGAGG + Intronic
1117935024 14:60894142-60894164 GGTTTCCTGCCTTTCCTCAGTGG + Intronic
1118761691 14:68884198-68884220 GGTGTCCTGCAGGTCCTCCATGG + Exonic
1121563076 14:94888414-94888436 GGTGCCGTGGCTGTCCTCCTGGG - Intergenic
1122024955 14:98869027-98869049 GGGGCCCTGCCTGGACCCCGGGG - Intergenic
1122326011 14:100881003-100881025 GTTGTCCTGCTTGTCCTGCGAGG + Exonic
1122604361 14:102938373-102938395 GGGGCCCGGCCTTTCCTCCTGGG + Exonic
1122722215 14:103728432-103728454 TGTCCCCTGCCTGCCCGCCGTGG + Intronic
1122816526 14:104316760-104316782 GGTGCCCTGCCGTTCCTGGGGGG + Intergenic
1123055759 14:105568874-105568896 GGTGCACTGCGTGTCCTCCCTGG - Intergenic
1123080116 14:105688393-105688415 GGTGCACTGCGTGTCCTCCCTGG - Intergenic
1123080164 14:105688647-105688669 GGTGCACTGCGTGTCCTCCCTGG - Intergenic
1123110540 14:105865000-105865022 GGGTCCCTGCCTGTCCTTGGGGG + Intergenic
1124367209 15:29080600-29080622 GATGCACTGCCTGTCCTGCGGGG + Intronic
1125749396 15:42018632-42018654 GCTGTCCAGCCTGTCCTCCCTGG - Intronic
1127632658 15:60841250-60841272 GGTGCCCTCCCTGACCTCCTGGG + Intronic
1128053568 15:64683602-64683624 AGTGACCTCCCTTTCCTCCGTGG + Exonic
1128530181 15:68439841-68439863 TGTGCCCTGCCTGCCCTTCAAGG + Intergenic
1130895409 15:88166516-88166538 GGAGCCCTCCCTTTCCTCCTGGG - Intronic
1131177633 15:90219974-90219996 TGGGCCCTGCCTTTCCTCAGGGG - Intronic
1131703794 15:94970851-94970873 CGTGCCCTCCGTGTCCTCCTCGG + Intergenic
1132163572 15:99565153-99565175 GGTGACCTGCCCGTGCCCCGGGG + Intergenic
1132326319 15:100973400-100973422 GGTGGCCTGTCTTTCCCCCGTGG + Intronic
1132384436 15:101390188-101390210 GGGGCTCTGCCTGCCCTCCTCGG + Intronic
1132672065 16:1106109-1106131 GCTTCCCTCCCTGTCCCCCGGGG + Intergenic
1132814917 16:1821093-1821115 GTTGGCCTGCCTGTCGTGCGAGG - Intronic
1133048905 16:3105717-3105739 GATGCTCTTCCTGTCCTCCCGGG + Intergenic
1135419814 16:22297967-22297989 GGTGCCCTCCCTGCCCATCGGGG - Intronic
1138026240 16:53524347-53524369 TGTGCCCTGTCTGGCCTCCGTGG - Intergenic
1138196008 16:55052813-55052835 GGTGCCCTCACTCTCCTCCCAGG + Intergenic
1140481501 16:75265227-75265249 GGAGCCGTGCCTGCCCTCCACGG - Intronic
1141181505 16:81756045-81756067 GGTGCCTTTCCTGTTCTCCATGG - Intronic
1141461323 16:84180191-84180213 GCTGCCCACCCTGGCCTCCGAGG + Exonic
1142376250 16:89708494-89708516 GCTGCCCATCCTGTCCTTCGTGG - Exonic
1142466477 17:140221-140243 GCTGCCCTGGCTGACCTCAGAGG - Intergenic
1143728391 17:8865776-8865798 GCTGCCCTGGCTGGCCCCCGTGG + Intronic
1144219247 17:13085048-13085070 GGTGCCCTTCCTGTACCCAGAGG - Intergenic
1145116877 17:20218532-20218554 AGAGCCCTGCCTGTGCTCAGGGG - Intronic
1145827002 17:27884589-27884611 GGTGCTCACCCTGTCCTCTGTGG + Intronic
1147467393 17:40620828-40620850 GGTGCCCTCCCTATACTCAGGGG - Intergenic
1148125821 17:45236276-45236298 GGAGCCCAGCCTGTCCTCACTGG + Intronic
1148491981 17:48029070-48029092 GCTGCCCTTCCTGTCCTCCCTGG - Intronic
1148855644 17:50577926-50577948 GGTGGCCTGGATGTCCTCTGAGG - Intronic
1151265933 17:72954883-72954905 GGTGACCTGCCTGACACCCGAGG - Intronic
1151671850 17:75575274-75575296 GGTACCCTGCCTGTCCCCCGAGG + Intergenic
1152094808 17:78266883-78266905 GGAGGCCTGTCTGACCTCCGGGG + Intergenic
1152152166 17:78608924-78608946 GGTGCCTGGCCTGTGCTCCAGGG + Intergenic
1152396433 17:80036083-80036105 GGAGCCCTGCCTTTCCTTTGGGG - Intergenic
1154038704 18:10832948-10832970 GCCTCCCTGCCTGCCCTCCGGGG + Intronic
1154307250 18:13239718-13239740 GATGCCCTGGCTGTCCTTGGCGG + Intronic
1156060040 18:33063270-33063292 GGTGCCCAGCATGTCATCTGGGG + Intronic
1156371620 18:36476439-36476461 GCTGCCCTGCCTGCCCTCTGTGG - Intronic
1158537199 18:58319008-58319030 GATGCCCTGCCTGTACTTGGAGG + Intronic
1160007074 18:75075500-75075522 GGTCTCCAGCCTGTCCCCCGAGG - Intergenic
1160543261 18:79637371-79637393 GGTGCCCGGCCAGGCCTCCGAGG + Intergenic
1161770039 19:6226113-6226135 AGAGCCCTGCCTGTCCTGCCTGG + Intronic
1162521133 19:11180185-11180207 GTTCCCCTTCCTGTCCCCCGGGG + Intronic
1162578168 19:11511408-11511430 GATGCCCTTCCTGACCTCCCTGG - Intronic
1163370302 19:16897610-16897632 GGAGCCCTCCCTGGCGTCCGAGG + Intronic
1165314454 19:35046132-35046154 TGACCCCTGCCTGTCCTGCGAGG - Intronic
1165763747 19:38337251-38337273 TGTTCCCTGCCGGTCCTCCGTGG + Exonic
1165855659 19:38878222-38878244 GGGGCCCTACCTGTTCTCGGAGG + Exonic
1166229938 19:41420872-41420894 GAGCCCCTTCCTGTCCTCCGGGG + Intronic
1167577292 19:50323899-50323921 GGAGCCCTTCCTGACCTACGTGG - Exonic
925673236 2:6333960-6333982 GTTGCCCAGCCTCTCCTTCGGGG - Intergenic
926007085 2:9380857-9380879 GGAGCCAAGCCTGTCCTCCTTGG + Intronic
927096057 2:19748296-19748318 GGTGCCGGGCCTGTCCACCTCGG + Intergenic
927698245 2:25251933-25251955 GCTGCTCTTCCTGTCCCCCGAGG + Intronic
928116857 2:28551317-28551339 GGTGCCCTGCCTAATCTCCATGG - Intronic
930101460 2:47606678-47606700 TCAGCCCTGCCTGTCCTCCAGGG - Intergenic
935071795 2:99700891-99700913 GGTCACCTGCCTGACCTCCTCGG + Intronic
935497933 2:103804737-103804759 AGTGTCCTGCCTGGCCTCCCTGG + Intergenic
936553353 2:113470283-113470305 CGTGCCCGGCCTGTCCTCTGTGG + Intronic
936990210 2:118355762-118355784 GGTGCCATTCCTCTCCTCTGTGG - Intergenic
943496761 2:188630093-188630115 GGTCCCCTGCCCTTCCTCCAGGG - Intergenic
945176421 2:207048155-207048177 GGTGCCCAGCCTGTCCTCCCTGG - Intergenic
946158491 2:217822059-217822081 GGAGCCCTGCCTGTCCTTTGGGG - Intronic
946422866 2:219574829-219574851 TGTGCCCTGCCTGTCCAGCCCGG - Exonic
948560482 2:238848244-238848266 GGTGCCCAGGCTGTCCACGGGGG - Exonic
948615235 2:239194148-239194170 AGGGCGCTGCCTGTCCTCCTTGG - Intronic
948646566 2:239408744-239408766 TTTGCCCTTCCTGTCCTCTGCGG - Intergenic
948770313 2:240248345-240248367 AGGGCCCTGCCTGTCCTCAGGGG + Intergenic
1168819375 20:762807-762829 GCTGGCCTGCCTGTCCTCACTGG - Intronic
1169204365 20:3731997-3732019 GGCACCCAGCCTCTCCTCCGAGG - Intergenic
1170665739 20:18384640-18384662 GGGGCCCAGCCTGGCCTCCATGG - Intronic
1171486666 20:25490776-25490798 GCTGCCCAGCCTCTCCTCCCGGG + Intronic
1172095590 20:32458541-32458563 GGTGTCATCCCTGTCCCCCGTGG - Intronic
1172167477 20:32907867-32907889 AGTGGCCTGCCTGTCCCCAGAGG - Intronic
1172479900 20:35264982-35265004 GAGGTCCTGCCTGTCCTCCAGGG - Intronic
1175237457 20:57524834-57524856 GGGGCCCTGCCAGGCCTCCGAGG - Intronic
1175576214 20:60062706-60062728 TGAGCCCTGCCTGTCCAACGTGG + Intronic
1175591253 20:60193762-60193784 GGTGCCCTGCCTTTGCTTAGTGG - Intergenic
1176080830 20:63272437-63272459 GCTCCCCTGCCGGTCCTCCATGG + Intronic
1179545072 21:42108214-42108236 GGTGCCTCTGCTGTCCTCCGTGG + Intronic
1179561912 21:42220637-42220659 GCTGCCCTGCCTTCCCTGCGTGG + Intronic
1179887373 21:44319925-44319947 GGTGCCCTGCCTGGCATGCGCGG + Intronic
1180047082 21:45312006-45312028 ATTGCACTGCCTGTGCTCCGGGG - Intergenic
1180193321 21:46179709-46179731 GGGGGCCTGGCTGTCCTCCAGGG + Intronic
1181273441 22:21674034-21674056 GCTGCCCTCCCCGCCCTCCGTGG - Intronic
1181633410 22:24163293-24163315 GGTGCCCTGGCTTTCCTCCCAGG + Intronic
1183027462 22:35076554-35076576 GGGGCCCTGGGTGTCCTCCATGG + Intronic
1183949024 22:41342457-41342479 GGTGCCCTGGCTGGCCCCAGTGG + Intronic
1184104511 22:42359696-42359718 GGTGGCCTGGCTGTCCCCAGCGG - Intergenic
1184730950 22:46370754-46370776 GCTTCCCTGACTGTCCTCAGTGG - Intronic
1184836676 22:47027937-47027959 GGGGCCCTGACTGTGCTCCACGG - Intronic
1185241552 22:49750044-49750066 CCTGCCCTGCCTGTCCTGCCTGG - Intergenic
950138455 3:10599502-10599524 GGCGCCATGCCTGCCCTCCAGGG - Intronic
950417427 3:12876387-12876409 TGCGCCCTGTCTGCCCTCCGCGG + Intergenic
952695844 3:36264449-36264471 GGTGACCTGCCCCTCCCCCGGGG + Intergenic
953183304 3:40616074-40616096 GGCTCCCTGCCTGCCCTCTGCGG + Intergenic
953339602 3:42122447-42122469 GGTTCCCTGCCTGTTCTACTAGG + Intronic
954296298 3:49676235-49676257 GCTGCCCTGCCGGGCCTTCGTGG - Intronic
954611853 3:51948480-51948502 AGTGCCCGCCCTGTCCCCCGGGG + Exonic
957654882 3:83061316-83061338 GGTGCCCTGCATCTCATCCATGG - Intergenic
961281374 3:125767499-125767521 CGTGGCCAGCCTGTCCTCCTGGG + Intergenic
962420638 3:135225836-135225858 GCTTCCCTGCCTGTCCTGCTTGG - Intronic
964414720 3:156435152-156435174 GGTGCCCTGCCCGTTTTCCCTGG - Intronic
966723296 3:183085937-183085959 GGGGCCCTGCCTGGCTGCCGAGG - Intronic
967267356 3:187702292-187702314 GGTGCCCTGCCTGGCTACCATGG - Exonic
968660492 4:1796830-1796852 GGTGCCCTCCCTGAGCTCCTGGG + Intronic
968830544 4:2931239-2931261 GGTGCCCTGCCTGTCCTCCGTGG - Exonic
968910169 4:3473500-3473522 GGAGCCCGGCCTGCCCTACGAGG + Exonic
969257882 4:6014987-6015009 AGTTCCCTGCCTGTCTTCCTGGG + Intergenic
969871534 4:10107746-10107768 GGTGTCCTTCATGTCCTCAGAGG - Intronic
973916108 4:55636261-55636283 GGTGCCCTGGCTGTGCCTCGGGG + Exonic
976342908 4:83964742-83964764 GGTGCCCTGCCTGTACCTGGAGG + Intergenic
981138141 4:141236429-141236451 GGTGTCCTGTCTTTCCTCCTGGG - Intergenic
981504913 4:145489197-145489219 GCAGCCCTGCCTGACCTCAGTGG + Intronic
984747766 4:183239601-183239623 TGTACACTGTCTGTCCTCCGTGG - Intronic
985067578 4:186138515-186138537 AGTGCCCTTCCTCTCCTCCAGGG + Intronic
986835460 5:11631934-11631956 TATGCCTTGCCTGTCCTCCCAGG - Intronic
992255634 5:74918079-74918101 AGTGTCCTGGCTGTCCTCTGGGG - Intergenic
997612598 5:135225707-135225729 GGTGACCTCCCTGTCCTCTCTGG + Intronic
997934113 5:138095862-138095884 GGTGCTCTGCCTGCCCTGCTAGG + Intergenic
997963364 5:138338634-138338656 GTTGCCCTGCCTGTCCCCGCGGG - Intronic
999074280 5:148780206-148780228 GGTGGCCTGCCCCTCCTCCTGGG - Intergenic
1002306769 5:178288116-178288138 GGTGCTCTGCCTTGCCTCCAGGG + Intronic
1002427489 5:179184889-179184911 GGTTCCCTGCCTTTCCCTCGAGG - Intronic
1003159213 6:3621022-3621044 GGTGCTCAGCCTGTCCTCCTGGG + Intergenic
1003382771 6:5639918-5639940 GGTCCCCTGCTTTTCCTCAGTGG + Intronic
1003482481 6:6546334-6546356 GGTGCACGGCCTCCCCTCCGCGG - Intergenic
1005882252 6:30070655-30070677 GCTACCCTGCCTGTCCACTGAGG - Exonic
1006595746 6:35191746-35191768 TGGGCCTTGCCTGTCCTCTGTGG - Intergenic
1006606656 6:35262229-35262251 GGTGCCCTCCCTATACTCAGAGG - Intronic
1006734270 6:36261417-36261439 GGAGCCCAGACTGTCCTCAGAGG - Intronic
1006900250 6:37495643-37495665 GGTGCCCTGGTTGTCCTAAGAGG + Intronic
1007401684 6:41606129-41606151 GGTCCCCAGCTTGACCTCCGGGG - Intergenic
1014724147 6:124955482-124955504 GCTGCACTGCCTGTTCCCCGGGG - Intergenic
1016705863 6:147106978-147107000 GGTCACCTGCATGTCCTCTGTGG + Intergenic
1017875029 6:158517146-158517168 GGTGCCCTCCCTGCCCCCAGAGG + Intergenic
1019154560 6:170030361-170030383 AGTGCCATGCCTGTCCTCTCAGG + Intergenic
1019429308 7:991330-991352 GGGGCCCTGGCTGTACCCCGTGG - Intergenic
1019544697 7:1568297-1568319 GGCGCCCTGCTTGCCCTCAGTGG - Intronic
1021175983 7:17449965-17449987 GGAGGCCTGCCTGTCCCCCTGGG + Intergenic
1021960188 7:25862802-25862824 GGTGTCCCGCCTGTCTCCCGGGG + Intergenic
1022308550 7:29173734-29173756 GGTGCCCGGCCTGTCCAACATGG + Intronic
1023835730 7:44066147-44066169 GGGCCCCTGTCTTTCCTCCGGGG + Intronic
1024469711 7:49754963-49754985 GCTGACCTGCCTGTCCACAGGGG - Intergenic
1024524374 7:50336233-50336255 GGAGCCCTGCCTGGCCCCGGCGG + Intronic
1029115670 7:98235897-98235919 CCTGCCCTGGCTGTCCTCCCTGG + Intronic
1029540379 7:101179285-101179307 GCTTCCCTGCCTGTCCCCTGCGG - Intronic
1030587281 7:111436026-111436048 GGTGTCCTGCCAGACCTCTGTGG + Intronic
1035070697 7:156143356-156143378 CGTGCCCTGGCTGCCCTGCGGGG + Intergenic
1037832228 8:22196495-22196517 GGTGGCCTGGGTGTCCTCAGGGG - Intronic
1043191189 8:77225186-77225208 GGTGGCCTGCCTCTCTTCCTTGG + Intergenic
1044549519 8:93496179-93496201 GGTGCTCTGCTTGCCCCCCGAGG - Intergenic
1049018220 8:139936550-139936572 GGTGCCCTGCCCTTGCTCAGGGG - Intronic
1049223844 8:141440381-141440403 AGTGACCTGCCTGCCCTCCCGGG - Intergenic
1049345238 8:142135385-142135407 GGTGCCGTCCCTTTCCTCCAGGG - Intergenic
1049899649 9:146882-146904 CGCGCCCGGCCTGTCCTCTGTGG - Intronic
1051256531 9:15219574-15219596 GGTGCCCTCCCTGTACCCTGAGG + Intronic
1052996027 9:34552039-34552061 GGTGCTCTGCATGTCCTCATGGG + Exonic
1053168446 9:35861169-35861191 GGAGCCCTGTCTGTCCTTCCGGG + Intergenic
1053456080 9:38234026-38234048 GGTGACCTGTGTCTCCTCCGTGG + Intergenic
1054347973 9:63987009-63987031 CGTGCCCGGCCTGTCCTCTGTGG - Intergenic
1054445701 9:65313356-65313378 CGTGCCCGGCCTGTCCTCTGTGG - Intergenic
1054484568 9:65708151-65708173 CGTGCCCGGCCTGTCCTCTGTGG + Intronic
1056426563 9:86483342-86483364 GGTGCCATGCATGACCTCTGGGG + Intergenic
1056925239 9:90828829-90828851 GGTGACTTGACTGTCCTCCCTGG + Intronic
1057182288 9:93036625-93036647 GGTGCCCTGCTTGTCTTCCCAGG - Intergenic
1057715980 9:97496560-97496582 AGTGTCCTGCCTGACCTCCTGGG + Intergenic
1060475872 9:123986079-123986101 GGTCCCCTGCCAGTCTTCAGTGG - Intergenic
1060783856 9:126433616-126433638 GCTGCCCTGCCTTTCCTGCTTGG + Intronic
1061163813 9:128911131-128911153 AATGCCCTGTCTGTCCTCCTGGG + Intronic
1062373395 9:136251819-136251841 GGCGCCCACCCTGTCCACCGGGG + Intergenic
1062415566 9:136447610-136447632 GCTGCCCCGCCTGCCCTCCCAGG - Exonic
1062449265 9:136608693-136608715 GGGGCCCAGCCTGGCCTCCCTGG + Intergenic
1062483332 9:136762495-136762517 GGTGGTCTGGCTGTCCTCCTGGG + Intronic
1185650308 X:1642693-1642715 GGTGCCCTGACTGTCCTCTGAGG + Intronic
1187960601 X:24563444-24563466 GGTGCCCTGCCTGCGCTTCCTGG - Intronic
1188003221 X:25001195-25001217 GGGGCTCTGCATGTCCTCCATGG + Intergenic
1192357991 X:70421730-70421752 GGTGACCTGCTGGTCCTCCCTGG + Intergenic
1194084202 X:89505877-89505899 GGTGCCCTGCATCTCAGCCGTGG - Intergenic
1195669057 X:107453769-107453791 GGTGCTCTGCCTGTCATGGGTGG - Intergenic
1200129214 X:153831766-153831788 GGAGCCCTTCCTTTCCTCCCTGG + Intergenic
1200436843 Y:3161763-3161785 GGTGCCCTGCATCTCAGCCGTGG - Intergenic