ID: 968830552

View in Genome Browser
Species Human (GRCh38)
Location 4:2931271-2931293
Sequence GCGGCTGGTGGGAGACATCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968830539_968830552 22 Left 968830539 4:2931226-2931248 CCATAGCCAGCGACCACGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
968830541_968830552 16 Left 968830541 4:2931232-2931254 CCAGCGACCACGGAGGACAGGCA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
968830544_968830552 9 Left 968830544 4:2931239-2931261 CCACGGAGGACAGGCAGGGCACC 0: 1
1: 0
2: 4
3: 26
4: 224
Right 968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968830552 Original CRISPR GCGGCTGGTGGGAGACATCG AGG Exonic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG + Intergenic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG + Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG + Intronic
1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG + Intronic
1085159396 11:74326897-74326919 GCAGCTGACGGGAGTCATCGAGG - Intergenic
1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG + Intergenic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG + Intronic
1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG + Intronic
1101891062 12:108715774-108715796 GCGGTTGGTGTGAGACCTCTTGG - Intronic
1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG + Exonic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1125717460 15:41827464-41827486 GCGGCTGGTGTGGGAAGTCGGGG - Exonic
1128757109 15:70190558-70190580 GCTGCTGTTTGGAGCCATCGAGG - Intergenic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1136628583 16:31476604-31476626 GGGGCTGGGGCGAGACGTCGAGG - Intronic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1142680994 17:1548576-1548598 GTGGCTGGTGGGGCACGTCGTGG - Intronic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1160904322 19:1445394-1445416 GCGGGAGGTGGGAGCCACCGCGG - Intergenic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG + Exonic
1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG + Intergenic
1167832581 19:52038183-52038205 GCTGCTTGTTGGAGAAATCGTGG - Intronic
925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG + Intergenic
927902041 2:26827448-26827470 GCGGCAGGTGGCAGACTTAGAGG - Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
934242250 2:90280261-90280283 GCGGGGGGGGGGAGACATCCAGG - Intergenic
937572476 2:123380987-123381009 GCGGCTGCTGTGAGAGATAGGGG - Intergenic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG + Intronic
948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG + Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
948983880 2:241508489-241508511 GCTGCGGGTGGGAGCCTTCGCGG - Exonic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1175366806 20:58461432-58461454 GCGGCTGGTGGGTCAGCTCGGGG - Exonic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
950717956 3:14863021-14863043 GAGGCGGGTGGGGGACATCAGGG - Intronic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
960734913 3:120768361-120768383 GTGCCTGATGGGAGACATTGAGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
966484705 3:180454809-180454831 GCGTCTGGTGGAAGACAGCTAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
992961081 5:81957125-81957147 GCCGCTGCTCGGAGACATGGTGG - Intergenic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG + Intergenic
1002522618 5:179800050-179800072 GCAGCTGGAGGATGACATCGTGG - Exonic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG + Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1012172659 6:96038606-96038628 GCAGCTGGTGGGAAACATATTGG - Intronic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG + Intergenic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1023477143 7:40593057-40593079 GCGGCTGGTAGGACACAAAGGGG + Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024432181 7:49301758-49301780 GGGGCTGGTGAGTGACATCAGGG + Intergenic
1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG + Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1041173663 8:55171306-55171328 GCGTCTGGTGGGAGACACAATGG + Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG + Intronic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG + Intronic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060597375 9:124856522-124856544 GCGCCTGGTGGGAGACTGCTGGG - Exonic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1187392327 X:18894305-18894327 GCTGCTGGTGGAAGCCATCATGG - Exonic
1188892314 X:35625945-35625967 GCGGCTGGTGGGGAGCATGGCGG + Intergenic
1190789730 X:53687048-53687070 GCGGAGGGTGGGAGACGACGTGG + Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic