ID: 968830880

View in Genome Browser
Species Human (GRCh38)
Location 4:2932553-2932575
Sequence GGGTCCTGGTGGTGACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968830880_968830891 17 Left 968830880 4:2932553-2932575 CCCAGAAGTCACCACCAGGACCC 0: 1
1: 0
2: 0
3: 17
4: 210
Right 968830891 4:2932593-2932615 CACTTACCATGCCTTGACTGCGG 0: 1
1: 0
2: 0
3: 9
4: 121
968830880_968830894 25 Left 968830880 4:2932553-2932575 CCCAGAAGTCACCACCAGGACCC 0: 1
1: 0
2: 0
3: 17
4: 210
Right 968830894 4:2932601-2932623 ATGCCTTGACTGCGGGCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 81
968830880_968830892 18 Left 968830880 4:2932553-2932575 CCCAGAAGTCACCACCAGGACCC 0: 1
1: 0
2: 0
3: 17
4: 210
Right 968830892 4:2932594-2932616 ACTTACCATGCCTTGACTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968830880 Original CRISPR GGGTCCTGGTGGTGACTTCT GGG (reversed) Intronic