ID: 968831007

View in Genome Browser
Species Human (GRCh38)
Location 4:2933039-2933061
Sequence AACCCCATGGGGCTACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968830995_968831007 -3 Left 968830995 4:2933019-2933041 CCACCTCCCTCTCCCCACCTAAC 0: 1
1: 0
2: 30
3: 600
4: 9370
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830993_968831007 4 Left 968830993 4:2933012-2933034 CCCACAGCCACCTCCCTCTCCCC 0: 1
1: 0
2: 12
3: 164
4: 1345
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830998_968831007 -10 Left 968830998 4:2933026-2933048 CCTCTCCCCACCTAACCCCATGG 0: 1
1: 1
2: 1
3: 53
4: 459
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830997_968831007 -9 Left 968830997 4:2933025-2933047 CCCTCTCCCCACCTAACCCCATG 0: 1
1: 0
2: 3
3: 53
4: 616
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830991_968831007 21 Left 968830991 4:2932995-2933017 CCAGTGGCCATGAGGGGCCCACA 0: 1
1: 0
2: 0
3: 15
4: 225
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830992_968831007 14 Left 968830992 4:2933002-2933024 CCATGAGGGGCCCACAGCCACCT 0: 1
1: 0
2: 4
3: 46
4: 733
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830990_968831007 25 Left 968830990 4:2932991-2933013 CCAACCAGTGGCCATGAGGGGCC 0: 1
1: 0
2: 0
3: 16
4: 182
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830996_968831007 -6 Left 968830996 4:2933022-2933044 CCTCCCTCTCCCCACCTAACCCC 0: 1
1: 0
2: 15
3: 211
4: 3070
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
968830994_968831007 3 Left 968830994 4:2933013-2933035 CCACAGCCACCTCCCTCTCCCCA 0: 1
1: 1
2: 37
3: 261
4: 1921
Right 968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968831007 Original CRISPR AACCCCATGGGGCTACTGGC TGG Intronic
900614948 1:3561280-3561302 GTCCCCAGGGGGCTCCTGGCTGG - Intronic
901028392 1:6291604-6291626 GAGCCCAGGGAGCTACTGGCAGG - Intronic
902467693 1:16628393-16628415 AACCCCATGGGGGCACTGTCAGG + Intergenic
902506888 1:16944335-16944357 AACCCCAGGGGGGCACTGTCAGG - Intronic
907404975 1:54248403-54248425 GGCCTCATGGGGCTACTGGAGGG - Intronic
914822810 1:151118087-151118109 AACTCCATTGGGCTGCTGTCGGG - Exonic
915512896 1:156396300-156396322 ACCCACATGGCGCTACTGGGGGG - Intergenic
922717838 1:227886403-227886425 ACCCCCATGGGGCTCCAGGTGGG + Intergenic
922731760 1:227952200-227952222 AATCCCTTGGGGCTTCTGCCAGG - Intergenic
1065162352 10:22936109-22936131 AACCACATGTGCCTAGTGGCTGG - Intronic
1066239361 10:33518271-33518293 GACCCCATGTGGCTGATGGCAGG - Intergenic
1068586912 10:58810119-58810141 AACCCTATGGGGATAAGGGCAGG + Intronic
1070761750 10:79028344-79028366 CACCTCATAGGGCTGCTGGCAGG - Intergenic
1072058790 10:91788206-91788228 AATCCCATGGGCCTACTACCTGG - Intergenic
1073556044 10:104452713-104452735 AGCCACATGTGGCTAGTGGCTGG + Intronic
1075166121 10:120069795-120069817 AACCCCATGGGGTTACTATGGGG + Intergenic
1081826279 11:46056271-46056293 TACCCCATGGGACACCTGGCAGG + Intronic
1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG + Intronic
1086120976 11:83304219-83304241 CAGCCAATGGGGCAACTGGCAGG - Intergenic
1091575232 12:1727711-1727733 TACCCCAAGGGGCTACTGAAAGG - Intronic
1091897750 12:4118795-4118817 GACCACATGGTGCTTCTGGCAGG + Intergenic
1096428657 12:51525149-51525171 AGCCACATGTGGCTAATGGCTGG + Intergenic
1098950495 12:76636029-76636051 AACCTCATGGGATTACTGTCTGG - Intergenic
1113659042 13:112091717-112091739 AACCACATGGGGCTAGTGGCAGG + Intergenic
1121551975 14:94809728-94809750 GACCCCATGGGGCATCTGGAGGG + Intergenic
1122316081 14:100826896-100826918 GATCCTAGGGGGCTACTGGCAGG - Intergenic
1123924761 15:25097068-25097090 TACTTCATGAGGCTACTGGCTGG - Intergenic
1131970103 15:97883149-97883171 ATCCCCATGAGGCCATTGGCAGG + Intergenic
1132067643 15:98745345-98745367 AACCACATGGGGCCACTAGTGGG - Intronic
1133827888 16:9295114-9295136 ATCCCCCTGGTGCTACTGGGTGG - Intergenic
1134414614 16:14032726-14032748 AACCCCAGGTAGCTACTGCCAGG + Intergenic
1136135713 16:28255817-28255839 AACCCCATGGGGCTGGGGGGAGG + Intergenic
1140233089 16:73134065-73134087 TACCTCATAGGGCTACTGGGGGG - Intronic
1141429856 16:83965900-83965922 TACGCCATGGGGCCGCTGGCCGG + Exonic
1141675394 16:85514747-85514769 AACCCCCTGGGGCAAGGGGCAGG - Intergenic
1142187549 16:88701630-88701652 AACCACAGGGGCCTACTGTCAGG - Intronic
1143193494 17:5057827-5057849 AAACCAATGGGGTTAGTGGCAGG - Intergenic
1144640755 17:16935321-16935343 CACCCCAGAGGGCTACTGGGAGG - Intronic
1145780062 17:27557009-27557031 TGTCCCATGGGGCCACTGGCAGG - Intronic
1148646899 17:49224403-49224425 TGCCCCATGGGGCTGCTGGCGGG - Exonic
1148955269 17:51348515-51348537 AAACCCATGGGACTGTTGGCAGG + Intergenic
1150242469 17:63646164-63646186 ATCCCTGTGGGGCCACTGGCTGG + Intronic
1151546496 17:74796530-74796552 AACCCCAAGGGGCCACTGAAGGG + Intronic
1152836809 17:82538596-82538618 AACCCCATGCGGCTCCTGTGGGG - Intronic
1155030833 18:21982117-21982139 AAGCCCTTGGGGATACTGGTAGG + Intergenic
1157549049 18:48568339-48568361 CACCTCATGGGGCTGCTGGGAGG - Intronic
1160040586 18:75341514-75341536 TACCCCGTGGGGCTACTCTCAGG - Intergenic
1162113458 19:8413664-8413686 AACCTGATGGGGCTTCTGGGAGG + Intronic
1165341421 19:35214714-35214736 TACCTCATGGGGCTGCTGGAAGG + Intergenic
1165609087 19:37134547-37134569 AACCTCGTGGGTCTTCTGGCAGG - Intronic
1167152206 19:47716784-47716806 AAGCCCATGGTGCTGGTGGCCGG + Exonic
925947255 2:8877151-8877173 AACTTCATGGGGATCCTGGCAGG - Exonic
926712458 2:15892293-15892315 TACCTCATGGGGCTGCTGGGAGG - Intergenic
931949808 2:67349967-67349989 GTCCCCATTGGGCTACTGCCTGG - Intergenic
933844260 2:86312721-86312743 TACCCCATGGGGCTACAGTCAGG + Intronic
933861691 2:86475672-86475694 TGCCCCATGGTGCTTCTGGCTGG - Intronic
938656092 2:133435726-133435748 ATCCACATGTGGCTAGTGGCTGG + Intronic
943951880 2:194140302-194140324 AACACCATTTGACTACTGGCTGG + Intergenic
946194870 2:218026967-218026989 AAGTTCTTGGGGCTACTGGCTGG + Intergenic
947749328 2:232524461-232524483 TACCCCATGGGGCAACAGGGTGG + Intronic
948610320 2:239162454-239162476 AACTCCATTGTCCTACTGGCTGG - Intronic
948766609 2:240225311-240225333 AACCCCCTGGGCTTCCTGGCAGG - Intergenic
948783974 2:240341292-240341314 AACCCCAAGTGGCTCCTGGAAGG - Intergenic
1169140072 20:3222764-3222786 AGCCCCATATGGCTAGTGGCTGG - Intronic
1169492119 20:6080180-6080202 AGCCACATGGGCCTCCTGGCAGG - Intronic
1170789624 20:19497035-19497057 TACCCCATGGGGTAAATGGCTGG - Intronic
1174920999 20:54701988-54702010 GAACCCATGGGACTCCTGGCTGG - Intergenic
1176075027 20:63244488-63244510 AACCCCTGGTGGCTGCTGGCTGG - Intronic
1184039490 22:41934494-41934516 AACCCCCTAGGCCTACAGGCTGG - Intergenic
950126853 3:10514867-10514889 AACCCCCTGGGGCCACCTGCAGG - Intronic
955166015 3:56512048-56512070 AATCACATGGGGCCAGTGGCAGG + Intergenic
968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG + Intronic
968962742 4:3753560-3753582 CACCCCTGGGGGCTCCTGGCTGG + Intergenic
970237823 4:13976451-13976473 TTCCCCCTGGGGCAACTGGCTGG - Intergenic
970401239 4:15719761-15719783 CAGCCCATGGGGCTGCTGGAAGG - Intronic
973701798 4:53544806-53544828 AACCTCATGGAGCTACTGTGAGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977928077 4:102723661-102723683 AACCCCATGGGGTTAGTGTGGGG - Intronic
980520857 4:133932048-133932070 AGCCCCATGTGGCTACTGCATGG + Intergenic
984855149 4:184188795-184188817 AATCCCCTGGGCCTACTGGTAGG + Intronic
984886126 4:184451456-184451478 GACCCCATGGGGTTACTGTGAGG - Intronic
992954407 5:81892383-81892405 AACTTCACGGGGCTACTGCCAGG + Intergenic
993000467 5:82375803-82375825 AACGTCAGGGTGCTACTGGCAGG - Intronic
995319495 5:110816765-110816787 AATCCTATGGGGCCACTAGCAGG - Intergenic
996004740 5:118406145-118406167 TACCCCATGGGGCTCCTGAGGGG + Intergenic
997697012 5:135869689-135869711 AGACCCATGGTGCTACTGCCTGG - Intronic
999658049 5:153829915-153829937 AAGCCCATGGGGCATTTGGCTGG + Intergenic
1000153541 5:158527755-158527777 AACCCCAGGGGACTACTGATAGG + Intergenic
1013491005 6:110646385-110646407 CTGCCCATGGGGCTGCTGGCGGG + Intronic
1022156205 7:27663897-27663919 AACCCCTTGGGGGTAATTGCAGG + Intergenic
1023745678 7:43320411-43320433 AACCCCATAGCACTGCTGGCAGG - Intronic
1024755565 7:52526081-52526103 AAGCCCAGAGGGCTGCTGGCAGG + Intergenic
1033638949 7:143242054-143242076 AAAACCCTGGTGCTACTGGCAGG + Intergenic
1034683934 7:152953323-152953345 CACCTCATGGGGCTAGTGGGGGG - Intergenic
1035246051 7:157562522-157562544 AACCACATGTGGCTACTGTATGG + Intronic
1036190344 8:6664356-6664378 AACCTCATGGGGCTCGTGGCTGG - Intergenic
1037890781 8:22622774-22622796 AACCCAATGGGGCGGCTGGAGGG + Intronic
1040483051 8:47843672-47843694 AACCCCATCAGGCTACCAGCGGG + Intronic
1041236615 8:55809380-55809402 AGCCACATGTGGCTACTAGCTGG - Intronic
1044924440 8:97198216-97198238 AACCTCATAGGGCTACTGTGAGG - Intergenic
1049157068 8:141073740-141073762 AACCCCCTGGGGCTGCAGGCAGG - Intergenic
1050355918 9:4782411-4782433 AAGCCCATGGGAGTACTGCCAGG - Intergenic
1054707479 9:68477790-68477812 TACCCCATGGGGTTACTGTCAGG - Intronic
1055716476 9:79123446-79123468 AACCCGATGGGAGTACTGGTAGG - Intergenic
1056652297 9:88476536-88476558 AACCCCAAGGGGCCACTGAATGG - Exonic
1056757644 9:89391897-89391919 AAACCCAAGGCTCTACTGGCTGG + Intronic
1059392542 9:114008230-114008252 AAACCCATGGGGATAGGGGCTGG + Intronic
1059456879 9:114405438-114405460 AACCTCATAGGGCTACTGGGAGG + Intronic
1060945198 9:127566412-127566434 AGCCCCACGGGGCTGGTGGCAGG - Intronic
1061600848 9:131669105-131669127 AGCCCCATGGGCCTGCAGGCAGG + Intronic
1062398758 9:136363341-136363363 CACCCCTTGGGGCTTCTGGGAGG - Intronic
1189319022 X:40076138-40076160 AACCCTAAGGGGCTACTTGGAGG + Intronic
1196735776 X:118979787-118979809 AAATCCTTGGGGATACTGGCAGG - Intronic
1201168585 Y:11234979-11235001 CACCCCAGGGGGGTCCTGGCTGG - Intergenic