ID: 968833742

View in Genome Browser
Species Human (GRCh38)
Location 4:2947786-2947808
Sequence GCTAAGCACTAGAAGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968833739_968833742 13 Left 968833739 4:2947750-2947772 CCTTCTAAAATGTAAGCAAATAC 0: 1
1: 0
2: 2
3: 37
4: 379
Right 968833742 4:2947786-2947808 GCTAAGCACTAGAAGGTGTAGGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968833742 Original CRISPR GCTAAGCACTAGAAGGTGTA GGG Intronic
901883336 1:12206715-12206737 GCTAAGCACAAGATGGGGTGGGG - Intronic
910704608 1:90114969-90114991 GCTAGGCAATAGAAGCTCTAGGG - Intergenic
912180393 1:107212113-107212135 TATGAGAACTAGAAGGTGTAGGG + Intronic
917064277 1:171074639-171074661 TCTAAGCAATAGAAGTTGTCTGG + Intergenic
919838934 1:201595265-201595287 GCTAGGCACAAGGATGTGTAAGG + Intergenic
1068488563 10:57692479-57692501 GGTAACCACTAGAAGCTGAAAGG + Intergenic
1070460406 10:76662331-76662353 GCTAAGAAGTAAAAGGTATAAGG + Intergenic
1074216667 10:111391697-111391719 GCTAAACAGTAGATGGAGTAAGG + Intergenic
1075879445 10:125837810-125837832 GGCAGGCACCAGAAGGTGTAAGG - Intronic
1077537197 11:3130041-3130063 GCCCAGCACTACTAGGTGTAGGG - Intronic
1086827578 11:91518626-91518648 GGCAAGGACTAGAATGTGTAGGG - Intergenic
1086918832 11:92562660-92562682 CCTAAGAACTAGAGGGTGAAGGG + Intronic
1087658376 11:100955053-100955075 GCTAGGAAATTGAAGGTGTAAGG + Intronic
1094193403 12:27720008-27720030 GCTAACCACTACAAGGTATTAGG + Intronic
1104156561 12:126138550-126138572 GATAAGGACTAGCAGGTATAAGG + Intergenic
1104615404 12:130264109-130264131 CCTAAGCAGAAGAAGGTATAGGG - Intergenic
1107383055 13:39877521-39877543 GGTAAGCAAGAGAAAGTGTAAGG - Intergenic
1119821474 14:77619991-77620013 GCTAAGCACCAGAAGTGGTTTGG - Intergenic
1133212316 16:4270611-4270633 GCCAAGGACTTGAAGGTGTAGGG - Intronic
1138104443 16:54280198-54280220 GCAAAGCACTCCAAGGTGTGTGG - Intergenic
926906033 2:17806533-17806555 GGAAAGCACTAGAAGTGGTAGGG + Intergenic
931799974 2:65748788-65748810 GCTAAGCCCCAGAGGGTCTACGG - Intergenic
934927786 2:98393709-98393731 CCCAAGCACAAGAAGGTGCAGGG - Intronic
935582344 2:104767439-104767461 GCCAAGGACTAGATGGTGAAAGG - Intergenic
940863146 2:158790578-158790600 GCTAAGAAGTCGAAGGTGGAGGG - Intergenic
941354065 2:164467364-164467386 GATAAAGAATAGAAGGTGTAGGG + Intergenic
943524961 2:189004785-189004807 GCTAAGCACTAGAATGTTATAGG - Intronic
946366740 2:219253431-219253453 GCTTGGCGCTAGAAGGTGGAAGG - Intronic
1172436508 20:34932356-34932378 GGGAAACAATAGAAGGTGTAAGG + Intronic
1177730845 21:25025234-25025256 GCTTAGGACTGGGAGGTGTATGG + Intergenic
1181389354 22:22568705-22568727 GGAAAGCACTAGAAGGTGCCAGG - Intergenic
1182865646 22:33601999-33602021 GCTAAGAAGTTGAAGGAGTAAGG - Intronic
956043451 3:65170771-65170793 GCTATGCACTGGAAGTTGGAAGG - Intergenic
956932373 3:74059443-74059465 GATCAGCACTAAAATGTGTAAGG + Intergenic
960064798 3:113359786-113359808 GCTAACCACTAGCAGGTACATGG + Intronic
960613743 3:119578839-119578861 ACTAAGAGCTAGAGGGTGTAGGG + Intergenic
966181625 3:177193979-177194001 GCTATGCTCTAGGAGGTGTGAGG - Intronic
967861696 3:194156880-194156902 GCTCAGCACTGGAGGGTTTAAGG + Intergenic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
968833742 4:2947786-2947808 GCTAAGCACTAGAAGGTGTAGGG + Intronic
969238666 4:5885752-5885774 GCTAAGCTCTAGAAGGGCCAGGG + Intronic
969833839 4:9822161-9822183 GCTAACCAAAAGAAGGAGTATGG - Intronic
971380928 4:26097010-26097032 GGTAATCACAAGAAGGTGTTGGG + Intergenic
972546173 4:40082668-40082690 GTTAAGCACCAGGAGGTGTTGGG - Intronic
972977294 4:44652198-44652220 CCTAACCACTGGAAGGTGTTAGG + Intronic
978465901 4:109008631-109008653 GCTGAGCACTACAAGGTATGAGG + Intronic
982731995 4:158965866-158965888 GCTAAGCACTAGGAGATGGTGGG + Intronic
983131743 4:164028560-164028582 GCAAACTACTAGAAGGGGTAGGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
988205533 5:28128990-28129012 GTTAAGCAGTACAAGGTGTTGGG + Intergenic
988573980 5:32401329-32401351 GATAAGCACTATAAGAAGTATGG + Intronic
996049516 5:118916225-118916247 GGTAAACACTAGAAGGTGACAGG - Intronic
1005581032 6:27235386-27235408 TCTAAGAATTAGAAAGTGTAGGG + Intergenic
1011264261 6:85498677-85498699 GCAAGGCACTAGCAGGTGTCTGG + Intergenic
1013405348 6:109838285-109838307 GCTCTGCACTAGAAGGAGCAGGG - Intergenic
1013405501 6:109839377-109839399 GCTCTGCACTAGAAGGAGCAGGG + Intergenic
1013892837 6:115045691-115045713 GCTTTGCACTTGAAGGTATATGG + Intergenic
1023965213 7:44960585-44960607 GCTAGGCACCTGCAGGTGTAGGG - Intergenic
1036942129 8:13061757-13061779 CCTAAGCACAAGAAGCTGTGAGG - Intergenic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1050896692 9:10891492-10891514 GGTATTCACTAGATGGTGTAAGG - Intergenic
1052010596 9:23403966-23403988 GCTAAGCACTAGAAATAGAATGG - Intergenic
1057581618 9:96292030-96292052 GCAAAGAAATAGAAGATGTAAGG + Intronic
1060162070 9:121372971-121372993 CCTAAGCACCACAAGGTGTTGGG - Intergenic
1060662549 9:125412974-125412996 GCTCAGCACTGCAGGGTGTAGGG - Intergenic
1191577021 X:62717093-62717115 GGTAAAAACTAGAAAGTGTAGGG - Intergenic
1196532612 X:116806551-116806573 GCTTAGCACTAGAAGTTGCTAGG + Intergenic