ID: 968835946

View in Genome Browser
Species Human (GRCh38)
Location 4:2964155-2964177
Sequence CCCGGGATTCGGGGTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968835946_968835956 -2 Left 968835946 4:2964155-2964177 CCCAGAGAACCCCGAATCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 968835956 4:2964176-2964198 GGGAACCCTGGCCCCCCTGAAGG 0: 1
1: 0
2: 2
3: 24
4: 203
968835946_968835964 14 Left 968835946 4:2964155-2964177 CCCAGAGAACCCCGAATCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968835946 Original CRISPR CCCGGGATTCGGGGTTCTCT GGG (reversed) Intronic
900569415 1:3351057-3351079 CCCAGGACACGGGGATCTCTTGG - Intronic
901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG + Intergenic
903802809 1:25982313-25982335 CCCAGTATTCAGGGTTTTCTCGG - Intronic
908835220 1:68222975-68222997 CCTGGGATTCAGGGGTCTCTGGG - Intronic
913225751 1:116696713-116696735 CCAGGGAATCCTGGTTCTCTGGG + Intronic
917276161 1:173333938-173333960 CCAGGGTTTCAGGGTTCTCCAGG + Intergenic
1066287541 10:33982681-33982703 CCTGGGATTCAGGGTTATATGGG + Intergenic
1067095135 10:43294895-43294917 ACAGGGATTCGGGGTGCTCAGGG - Intergenic
1073295585 10:102436371-102436393 CCCTGGAATAGGAGTTCTCTTGG + Intergenic
1077962505 11:7089786-7089808 CCCGGGGTTCGCGGTAGTCTCGG - Exonic
1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG + Intronic
1084583039 11:70036331-70036353 CCCTGGATTTGGGGGTCACTTGG + Intergenic
1088110683 11:106257857-106257879 CCCTGGCTTCTAGGTTCTCTGGG + Intergenic
1091391984 12:131333-131355 CCAGGGAGTGGGGGGTCTCTGGG - Intronic
1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG + Intronic
1096500010 12:52059016-52059038 CCCAGGCTTGGGGGTGCTCTGGG - Exonic
1097192320 12:57225424-57225446 CCCGGGCTTGGGGGCTCCCTCGG + Exonic
1109776208 13:67044069-67044091 CCCTGGAATGGGGGTTGTCTTGG + Intronic
1110624636 13:77638969-77638991 CCAGGGGTTAGTGGTTCTCTTGG + Intronic
1122114886 14:99522689-99522711 CCACGGGTTCGGGGCTCTCTCGG + Intronic
1131934183 15:97483900-97483922 GCCTGGATTTGGGGTTTTCTGGG + Intergenic
1132653636 16:1032471-1032493 CCTGGGATGTGGGGTTGTCTGGG - Intergenic
1134065292 16:11224490-11224512 CCCGGGAGAGGGGGGTCTCTGGG + Intergenic
1140033804 16:71358343-71358365 CTCGGGCTTCGGAGTTCACTAGG - Intergenic
1140461717 16:75145538-75145560 CCTGGGATTTGGGGTTCTTATGG - Intergenic
1143202621 17:5122901-5122923 CCCCGGCTTCGGGGTGCTCTCGG - Intronic
1143373336 17:6453904-6453926 CCAGGGAGTCGGGGTTTTCCAGG + Exonic
1143925004 17:10361833-10361855 ACCTGGATTGGGGGTTCCCTGGG + Intronic
1144971201 17:19110991-19111013 CTCGGGATTGGGGGTTTTTTGGG + Intergenic
1144991503 17:19237154-19237176 CTCGGGATTGGGGGTTTTTTGGG + Intronic
1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG + Intronic
1147996299 17:44362174-44362196 GCCAGGATTGGGGGTTCTCTGGG - Intronic
1149313464 17:55418489-55418511 TGTGAGATTCGGGGTTCTCTTGG - Intronic
1151434123 17:74083576-74083598 CCCGGGATTCAGAGGTCACTTGG + Intergenic
1160250616 18:77200641-77200663 CCCGGGATTTGGAGTGCACTGGG - Intergenic
932049014 2:68380607-68380629 CCTGGCATTTGGGTTTCTCTTGG + Intronic
935207136 2:100905886-100905908 CCAGGGATTTGTGGTTCTCATGG - Intronic
947123271 2:226839522-226839544 CCCGGAATCCGAGGTTCCCTAGG - Exonic
947323914 2:228954038-228954060 CCCGGGTTTAAGGTTTCTCTCGG - Intronic
949046523 2:241874862-241874884 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046826 2:241876342-241876364 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046929 2:241876660-241876682 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
1172504816 20:35454014-35454036 CCCCGGTTTAGGGATTCTCTGGG + Intronic
1172952545 20:38731161-38731183 CCAGGGTTTCGGGTTTCCCTTGG - Intergenic
1174362356 20:50037012-50037034 GCTGGGAATCTGGGTTCTCTCGG + Intergenic
1174516965 20:51100082-51100104 CCAGGGCTTCCAGGTTCTCTGGG + Intergenic
1183050671 22:35257960-35257982 CCCGCGATGCGGGGGTCCCTCGG + Intronic
949865462 3:8543311-8543333 CCCAGGGTTGGGGCTTCTCTCGG - Intronic
955536674 3:59930827-59930849 TCAGGGTTTCGGGGTTCTCAAGG - Intronic
960351849 3:116603415-116603437 CCCAGGATTCTGTATTCTCTTGG + Intronic
967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG + Exonic
968835946 4:2964155-2964177 CCCGGGATTCGGGGTTCTCTGGG - Intronic
969462535 4:7336367-7336389 CCGGGGAGTTGGGGGTCTCTGGG - Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
971732655 4:30406246-30406268 CCCTGTATTGGGGTTTCTCTTGG - Intergenic
987318266 5:16744525-16744547 CCAGGGTGTCGGGGTGCTCTGGG - Intronic
989283554 5:39672601-39672623 CCAGGGACTCGGGGTTCTTATGG + Intergenic
989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG + Intergenic
997519334 5:134512593-134512615 CCCAGGATTAGGGTCTCTCTGGG - Intergenic
997612586 5:135225651-135225673 CCAGGGGTTCGGCGTTCTGTGGG - Intronic
1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG + Intronic
1009325138 6:62339434-62339456 TCCAGGATGTGGGGTTCTCTGGG - Intergenic
1017962349 6:159233287-159233309 CTGTGGATTTGGGGTTCTCTGGG - Exonic
1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG + Intergenic
1030658242 7:112191609-112191631 CCCAGGCTTTGGGGTTCTATGGG - Intronic
1039630566 8:39107632-39107654 CCCCGGAGACGGGGTGCTCTCGG - Exonic
1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG + Intronic
1043386056 8:79748874-79748896 GCAGGGATTCCGGGGTCTCTGGG + Intergenic
1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG + Intergenic
1052192676 9:25677695-25677717 CCCGGGACTCGGAGCCCTCTGGG - Exonic
1060547805 9:124471076-124471098 CCCGGGCTTCCCGGGTCTCTTGG + Intronic