ID: 968835946

View in Genome Browser
Species Human (GRCh38)
Location 4:2964155-2964177
Sequence CCCGGGATTCGGGGTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968835946_968835964 14 Left 968835946 4:2964155-2964177 CCCAGAGAACCCCGAATCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835946_968835956 -2 Left 968835946 4:2964155-2964177 CCCAGAGAACCCCGAATCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 968835956 4:2964176-2964198 GGGAACCCTGGCCCCCCTGAAGG 0: 1
1: 0
2: 2
3: 24
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968835946 Original CRISPR CCCGGGATTCGGGGTTCTCT GGG (reversed) Intronic