ID: 968835964

View in Genome Browser
Species Human (GRCh38)
Location 4:2964192-2964214
Sequence CTGAAGGAACCCGACATCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968835953_968835964 3 Left 968835953 4:2964166-2964188 CCGAATCCCGGGGAACCCTGGCC 0: 1
1: 0
2: 0
3: 7
4: 135
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835935_968835964 27 Left 968835935 4:2964142-2964164 CCCCGACCCCCCCCCCAGAGAAC 0: 1
1: 0
2: 1
3: 40
4: 392
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835938_968835964 21 Left 968835938 4:2964148-2964170 CCCCCCCCCCAGAGAACCCCGAA 0: 1
1: 0
2: 0
3: 10
4: 183
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835937_968835964 25 Left 968835937 4:2964144-2964166 CCGACCCCCCCCCCAGAGAACCC 0: 1
1: 0
2: 3
3: 66
4: 634
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835944_968835964 15 Left 968835944 4:2964154-2964176 CCCCAGAGAACCCCGAATCCCGG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835941_968835964 18 Left 968835941 4:2964151-2964173 CCCCCCCAGAGAACCCCGAATCC 0: 1
1: 0
2: 2
3: 16
4: 159
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835955_968835964 -4 Left 968835955 4:2964173-2964195 CCGGGGAACCCTGGCCCCCCTGA 0: 1
1: 0
2: 3
3: 34
4: 365
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835934_968835964 28 Left 968835934 4:2964141-2964163 CCCCCGACCCCCCCCCCAGAGAA 0: 1
1: 1
2: 4
3: 87
4: 736
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835942_968835964 17 Left 968835942 4:2964152-2964174 CCCCCCAGAGAACCCCGAATCCC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835946_968835964 14 Left 968835946 4:2964155-2964177 CCCAGAGAACCCCGAATCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835948_968835964 13 Left 968835948 4:2964156-2964178 CCAGAGAACCCCGAATCCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835950_968835964 5 Left 968835950 4:2964164-2964186 CCCCGAATCCCGGGGAACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835952_968835964 4 Left 968835952 4:2964165-2964187 CCCGAATCCCGGGGAACCCTGGC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835954_968835964 -3 Left 968835954 4:2964172-2964194 CCCGGGGAACCCTGGCCCCCCTG 0: 1
1: 0
2: 3
3: 45
4: 447
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835940_968835964 19 Left 968835940 4:2964150-2964172 CCCCCCCCAGAGAACCCCGAATC 0: 1
1: 0
2: 0
3: 10
4: 211
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835936_968835964 26 Left 968835936 4:2964143-2964165 CCCGACCCCCCCCCCAGAGAACC 0: 1
1: 0
2: 2
3: 23
4: 374
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835943_968835964 16 Left 968835943 4:2964153-2964175 CCCCCAGAGAACCCCGAATCCCG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
968835939_968835964 20 Left 968835939 4:2964149-2964171 CCCCCCCCCAGAGAACCCCGAAT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 968835964 4:2964192-2964214 CTGAAGGAACCCGACATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968835964 Original CRISPR CTGAAGGAACCCGACATCCC CGG Intronic