ID: 968838972

View in Genome Browser
Species Human (GRCh38)
Location 4:2986792-2986814
Sequence CAATAGTACTAAAGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968838972 Original CRISPR CAATAGTACTAAAGGAAAGA TGG (reversed) Intronic
900696969 1:4018477-4018499 CAATAGCCCTAAATGATAGAAGG - Intergenic
900696969 1:4018477-4018499 CAATAGCCCTAAATGATAGAAGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
907901418 1:58744661-58744683 CAAAAGTTCAAAAGGAAAGCTGG - Intergenic
907901418 1:58744661-58744683 CAAAAGTTCAAAAGGAAAGCTGG - Intergenic
908642097 1:66236309-66236331 CAAGAGTACAAAGGCAAAGAAGG - Intronic
908642097 1:66236309-66236331 CAAGAGTACAAAGGCAAAGAAGG - Intronic
908648523 1:66306421-66306443 TAATAAGACAAAAGGAAAGAGGG + Intronic
908648523 1:66306421-66306443 TAATAAGACAAAAGGAAAGAGGG + Intronic
909209300 1:72803011-72803033 GAATAGTACTACAGTAAACATGG + Intergenic
909209300 1:72803011-72803033 GAATAGTACTACAGTAAACATGG + Intergenic
909556429 1:76959465-76959487 CAATAGAACATAAGGAAACATGG + Intronic
909556429 1:76959465-76959487 CAATAGAACATAAGGAAACATGG + Intronic
909679472 1:78275665-78275687 CAACAGTACAGAAGGAATGAGGG - Intergenic
909679472 1:78275665-78275687 CAACAGTACAGAAGGAATGAGGG - Intergenic
910067936 1:83175776-83175798 CAATATTATTAAAGGATACATGG - Intergenic
910067936 1:83175776-83175798 CAATATTATTAAAGGATACATGG - Intergenic
910304587 1:85748502-85748524 CTTTAGAACTAAAGGACAGAGGG + Intronic
910304587 1:85748502-85748524 CTTTAGAACTAAAGGACAGAGGG + Intronic
910998158 1:93131518-93131540 TAACAGTAGTAAAGGAAAGGAGG + Intronic
910998158 1:93131518-93131540 TAACAGTAGTAAAGGAAAGGAGG + Intronic
911034426 1:93525649-93525671 CAATTGTTCTAAAGGCAAGTTGG - Intronic
911034426 1:93525649-93525671 CAATTGTTCTAAAGGCAAGTTGG - Intronic
912792764 1:112668977-112668999 CAACAGAATTAAAGGGAAGAGGG - Intronic
912792764 1:112668977-112668999 CAACAGAATTAAAGGGAAGAGGG - Intronic
915270324 1:154749284-154749306 CAAGAGCCCTAAAGAAAAGACGG + Intronic
915270324 1:154749284-154749306 CAAGAGCCCTAAAGAAAAGACGG + Intronic
917076294 1:171208705-171208727 CAAAACTGCTAAAGGAATGAAGG - Intronic
917076294 1:171208705-171208727 CAAAACTGCTAAAGGAATGAAGG - Intronic
918978611 1:191525362-191525384 TCATATTACTAAGGGAAAGAAGG + Intergenic
918978611 1:191525362-191525384 TCATATTACTAAGGGAAAGAAGG + Intergenic
919999812 1:202789215-202789237 CAATAGTATTAAAGAAAGAAGGG + Intronic
919999812 1:202789215-202789237 CAATAGTATTAAAGAAAGAAGGG + Intronic
920014012 1:202891182-202891204 CAATACAACTCAGGGAAAGAGGG + Exonic
920014012 1:202891182-202891204 CAATACAACTCAGGGAAAGAGGG + Exonic
920419468 1:205821686-205821708 CAAAAGAACAGAAGGAAAGAAGG + Intergenic
920419468 1:205821686-205821708 CAAAAGAACAGAAGGAAAGAAGG + Intergenic
920782736 1:209010487-209010509 CAATAGAATTAAGGGGAAGAAGG + Intergenic
920782736 1:209010487-209010509 CAATAGAATTAAGGGGAAGAAGG + Intergenic
920953086 1:210591487-210591509 GAATAGTACTACAGTAAACATGG + Intronic
920953086 1:210591487-210591509 GAATAGTACTACAGTAAACATGG + Intronic
921591588 1:217010653-217010675 CAAAGGTACAAAATGAAAGATGG + Intronic
921591588 1:217010653-217010675 CAAAGGTACAAAATGAAAGATGG + Intronic
921598720 1:217083839-217083861 CTATAGTACTATAGTAAACATGG - Intronic
921598720 1:217083839-217083861 CTATAGTACTATAGTAAACATGG - Intronic
921796371 1:219349201-219349223 CAAGAGCACTAAAATAAAGAGGG - Intergenic
921796371 1:219349201-219349223 CAAGAGCACTAAAATAAAGAGGG - Intergenic
922001497 1:221483216-221483238 CAATAGCACTAATAGAATGAAGG - Intergenic
922001497 1:221483216-221483238 CAATAGCACTAATAGAATGAAGG - Intergenic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
924458338 1:244236228-244236250 CAAAAGTGCTAAAGGAAAAGGGG - Intergenic
924458338 1:244236228-244236250 CAAAAGTGCTAAAGGAAAAGGGG - Intergenic
1065833133 10:29632735-29632757 CAATAGTACTAAATAAAGGTAGG + Intronic
1065833133 10:29632735-29632757 CAATAGTACTAAATAAAGGTAGG + Intronic
1066264202 10:33759565-33759587 AAATACTACTTAAGGAACGATGG + Intergenic
1066264202 10:33759565-33759587 AAATACTACTTAAGGAACGATGG + Intergenic
1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG + Intergenic
1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG + Intergenic
1067259167 10:44672265-44672287 CAATAGTAAGAAAACAAAGAGGG + Intergenic
1067259167 10:44672265-44672287 CAATAGTAAGAAAACAAAGAGGG + Intergenic
1068414728 10:56705274-56705296 CAAGAGTTGTATAGGAAAGATGG - Intergenic
1068414728 10:56705274-56705296 CAAGAGTTGTATAGGAAAGATGG - Intergenic
1072509917 10:96111009-96111031 CAGTAGAACAAAGGGAAAGACGG + Intergenic
1072509917 10:96111009-96111031 CAGTAGAACAAAGGGAAAGACGG + Intergenic
1072606169 10:96984576-96984598 CAAGAGTACTGAAGGAATGAAGG + Exonic
1072606169 10:96984576-96984598 CAAGAGTACTGAAGGAATGAAGG + Exonic
1074475840 10:113773550-113773572 CAGTAGGCCGAAAGGAAAGATGG + Intronic
1074475840 10:113773550-113773572 CAGTAGGCCGAAAGGAAAGATGG + Intronic
1075143657 10:119864498-119864520 CAATAGTAGAAAAGAAAAAAAGG - Intronic
1075143657 10:119864498-119864520 CAATAGTAGAAAAGAAAAAAAGG - Intronic
1076387013 10:130064625-130064647 TCAAAGTACTATAGGAAAGAAGG - Intergenic
1076387013 10:130064625-130064647 TCAAAGTACTATAGGAAAGAAGG - Intergenic
1078503060 11:11902464-11902486 CAAAAGTGCTCAAGAAAAGAAGG - Intronic
1078503060 11:11902464-11902486 CAAAAGTGCTCAAGAAAAGAAGG - Intronic
1079024090 11:16932239-16932261 CAATAGTACTAAATAAATGATGG + Intronic
1079024090 11:16932239-16932261 CAATAGTACTAAATAAATGATGG + Intronic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079863640 11:25707038-25707060 CAATACTTATGAAGGAAAGAAGG - Intergenic
1079863640 11:25707038-25707060 CAATACTTATGAAGGAAAGAAGG - Intergenic
1081024318 11:37990758-37990780 CAGTAGTATTAAAGTAAAGCTGG + Intergenic
1081024318 11:37990758-37990780 CAGTAGTATTAAAGTAAAGCTGG + Intergenic
1082270862 11:50168166-50168188 AAAAAGAATTAAAGGAAAGAGGG - Intergenic
1082270862 11:50168166-50168188 AAAAAGAATTAAAGGAAAGAGGG - Intergenic
1082717811 11:56636713-56636735 GAATATTACTTAAGGACAGAAGG - Intergenic
1082717811 11:56636713-56636735 GAATATTACTTAAGGACAGAAGG - Intergenic
1086577394 11:88355557-88355579 TAATAATATTAAAAGAAAGAAGG + Intergenic
1086577394 11:88355557-88355579 TAATAATATTAAAAGAAAGAAGG + Intergenic
1086884228 11:92185223-92185245 CAATAGTACAAAAGGTGAGAGGG + Intergenic
1086884228 11:92185223-92185245 CAATAGTACAAAAGGTGAGAGGG + Intergenic
1088291346 11:108241666-108241688 GCATATTACTAAATGAAAGAAGG - Intronic
1088291346 11:108241666-108241688 GCATATTACTAAATGAAAGAAGG - Intronic
1089521221 11:119065441-119065463 CAAAAGAAGGAAAGGAAAGAAGG + Intergenic
1089521221 11:119065441-119065463 CAAAAGAAGGAAAGGAAAGAAGG + Intergenic
1090714058 11:129414466-129414488 CATTAATACTAAAGAAAAGAAGG - Intronic
1090714058 11:129414466-129414488 CATTAATACTAAAGAAAAGAAGG - Intronic
1091861924 12:3793064-3793086 AATGAGTACCAAAGGAAAGAAGG + Intronic
1091861924 12:3793064-3793086 AATGAGTACCAAAGGAAAGAAGG + Intronic
1092292839 12:7174087-7174109 CAAATGTGGTAAAGGAAAGAAGG - Intergenic
1092292839 12:7174087-7174109 CAAATGTGGTAAAGGAAAGAAGG - Intergenic
1093501817 12:19821875-19821897 CAAAATTACTAAAGCAAACATGG - Intergenic
1093501817 12:19821875-19821897 CAAAATTACTAAAGCAAACATGG - Intergenic
1093668818 12:21847986-21848008 CAATAGGAGTCAAGGAAAGGTGG - Intronic
1093668818 12:21847986-21848008 CAATAGGAGTCAAGGAAAGGTGG - Intronic
1095311552 12:40703765-40703787 CAATATAAATGAAGGAAAGAAGG - Intronic
1095311552 12:40703765-40703787 CAATATAAATGAAGGAAAGAAGG - Intronic
1095675190 12:44908536-44908558 CAATACCACCAAAGGAAAGAAGG + Intronic
1095675190 12:44908536-44908558 CAATACCACCAAAGGAAAGAAGG + Intronic
1096362699 12:51001906-51001928 CAAAAGGACTCAAGGGAAGATGG + Intronic
1096362699 12:51001906-51001928 CAAAAGGACTCAAGGGAAGATGG + Intronic
1098053241 12:66476122-66476144 CAAGACTAATAAAGAAAAGAGGG + Intronic
1098053241 12:66476122-66476144 CAAGACTAATAAAGAAAAGAGGG + Intronic
1098665509 12:73157664-73157686 CAAAAGTAGCAAAGGAAAGAAGG - Intergenic
1098665509 12:73157664-73157686 CAAAAGTAGCAAAGGAAAGAAGG - Intergenic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1100494290 12:95110302-95110324 CACTATTATTAAAGGAAAGCAGG + Intronic
1100494290 12:95110302-95110324 CACTATTATTAAAGGAAAGCAGG + Intronic
1100998154 12:100325909-100325931 CCATAGTTCTACAGGAAAAATGG - Intronic
1100998154 12:100325909-100325931 CCATAGTTCTACAGGAAAAATGG - Intronic
1101538825 12:105645757-105645779 CAATAATCCTAAAGAGAAGAGGG - Intergenic
1101538825 12:105645757-105645779 CAATAATCCTAAAGAGAAGAGGG - Intergenic
1105604878 13:21919090-21919112 CCAAAGTCCTAAAGGGAAGAGGG - Intergenic
1105604878 13:21919090-21919112 CCAAAGTCCTAAAGGGAAGAGGG - Intergenic
1109721333 13:66280098-66280120 CACTAGTACTAATGAAAAGAAGG - Intergenic
1109721333 13:66280098-66280120 CACTAGTACTAATGAAAAGAAGG - Intergenic
1109908358 13:68875392-68875414 CAATTGTACCAGAGGAAATATGG - Intergenic
1109908358 13:68875392-68875414 CAATTGTACCAGAGGAAATATGG - Intergenic
1110079180 13:71289476-71289498 CAATAGGAAGAAAGGAAGGAAGG + Intergenic
1110079180 13:71289476-71289498 CAATAGGAAGAAAGGAAGGAAGG + Intergenic
1110346166 13:74450157-74450179 CAACAGTTCAAAAGGAAGGATGG - Intergenic
1110346166 13:74450157-74450179 CAACAGTTCAAAAGGAAGGATGG - Intergenic
1110506432 13:76293028-76293050 AAATAGTGCTAAAGGAAAAGCGG - Intergenic
1110506432 13:76293028-76293050 AAATAGTGCTAAAGGAAAAGCGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112530032 13:100192200-100192222 CAATTGAACTAAAGCAAAGATGG - Intronic
1112530032 13:100192200-100192222 CAATTGAACTAAAGCAAAGATGG - Intronic
1113105389 13:106766419-106766441 AAATAGTACAAAAGGAACTATGG + Intergenic
1113105389 13:106766419-106766441 AAATAGTACAAAAGGAACTATGG + Intergenic
1114242919 14:20885508-20885530 CAATAGTACAAATGGAATGGGGG - Intergenic
1114242919 14:20885508-20885530 CAATAGTACAAATGGAATGGGGG - Intergenic
1114249846 14:20949445-20949467 CAATAGTACAAATGGAATGGGGG - Intergenic
1114249846 14:20949445-20949467 CAATAGTACAAATGGAATGGGGG - Intergenic
1114369419 14:22069712-22069734 GAAGAATACTAAAGAAAAGATGG - Intergenic
1114369419 14:22069712-22069734 GAAGAATACTAAAGAAAAGATGG - Intergenic
1114926087 14:27401253-27401275 AGATAGTAGTAAAGGTAAGAAGG - Intergenic
1114926087 14:27401253-27401275 AGATAGTAGTAAAGGTAAGAAGG - Intergenic
1116483460 14:45418870-45418892 AAAAAGTAAAAAAGGAAAGATGG + Intergenic
1116483460 14:45418870-45418892 AAAAAGTAAAAAAGGAAAGATGG + Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1116654199 14:47630676-47630698 TAATAGTACAAAAGGAAGTAAGG + Intronic
1116654199 14:47630676-47630698 TAATAGTACAAAAGGAAGTAAGG + Intronic
1117639460 14:57782973-57782995 CAATTGTAAAAAAGGAAGGAAGG + Intronic
1117639460 14:57782973-57782995 CAATTGTAAAAAAGGAAGGAAGG + Intronic
1118097411 14:62553015-62553037 AAAAAGTACTAAAAGAAATATGG + Intergenic
1118097411 14:62553015-62553037 AAAAAGTACTAAAAGAAATATGG + Intergenic
1118100763 14:62599886-62599908 CAACACTACAAAAGGAAGGAAGG + Intergenic
1118100763 14:62599886-62599908 CAACACTACAAAAGGAAGGAAGG + Intergenic
1119101260 14:71881884-71881906 CAATAAAAATAAAGGAAGGAAGG - Intergenic
1119101260 14:71881884-71881906 CAATAAAAATAAAGGAAGGAAGG - Intergenic
1119579905 14:75768598-75768620 GAAGAGTACTAAAGGAAGGTGGG + Intronic
1119579905 14:75768598-75768620 GAAGAGTACTAAAGGAAGGTGGG + Intronic
1120066538 14:80047520-80047542 TAAAAGTACTAGAGAAAAGATGG + Intergenic
1120066538 14:80047520-80047542 TAAAAGTACTAGAGAAAAGATGG + Intergenic
1120279456 14:82420624-82420646 TACAAGTGCTAAAGGAAAGAAGG - Intergenic
1120279456 14:82420624-82420646 TACAAGTGCTAAAGGAAAGAAGG - Intergenic
1120607826 14:86601623-86601645 GAATAATATTAAAGGTAAGATGG + Intergenic
1120607826 14:86601623-86601645 GAATAATATTAAAGGTAAGATGG + Intergenic
1121479466 14:94252211-94252233 CATTAAAACTAAAGAAAAGACGG + Intronic
1121479466 14:94252211-94252233 CATTAAAACTAAAGAAAAGACGG + Intronic
1121730345 14:96182395-96182417 CAATTGCAGTTAAGGAAAGAGGG - Intergenic
1121730345 14:96182395-96182417 CAATTGCAGTTAAGGAAAGAGGG - Intergenic
1122253451 14:100458210-100458232 TAATAGTAATAAAAGAAAGCTGG + Intronic
1122253451 14:100458210-100458232 TAATAGTAATAAAAGAAAGCTGG + Intronic
1123478999 15:20613857-20613879 CTATAGTATTAAGGGAAAGATGG + Intergenic
1123478999 15:20613857-20613879 CTATAGTATTAAGGGAAAGATGG + Intergenic
1123639013 15:22386528-22386550 CTATAGTATTAAGGGAAAGATGG - Intergenic
1123639013 15:22386528-22386550 CTATAGTATTAAGGGAAAGATGG - Intergenic
1124002464 15:25770493-25770515 CAAGAGAACTAAATGAATGAGGG + Intronic
1124002464 15:25770493-25770515 CAAGAGAACTAAATGAATGAGGG + Intronic
1124147953 15:27147107-27147129 CAAGAGTACTAAAAGAGAGCTGG + Intronic
1124147953 15:27147107-27147129 CAAGAGTACTAAAAGAGAGCTGG + Intronic
1126776260 15:52103184-52103206 CATTATTATAAAAGGAAAGAAGG - Intergenic
1126776260 15:52103184-52103206 CATTATTATAAAAGGAAAGAAGG - Intergenic
1127544865 15:59982965-59982987 CAATAGTACAAAAGACAGGAGGG + Intergenic
1127544865 15:59982965-59982987 CAATAGTACAAAAGACAGGAGGG + Intergenic
1128814159 15:70593783-70593805 AAATAGTATTTAAGGAAAAAAGG - Intergenic
1128814159 15:70593783-70593805 AAATAGTATTTAAGGAAAAAAGG - Intergenic
1131768946 15:95713835-95713857 CTAGAGAACTAAAGGCAAGAAGG + Intergenic
1131768946 15:95713835-95713857 CTAGAGAACTAAAGGCAAGAAGG + Intergenic
1133874829 16:9723923-9723945 TAATAATAATAAAAGAAAGAAGG - Intergenic
1133874829 16:9723923-9723945 TAATAATAATAAAAGAAAGAAGG - Intergenic
1134829365 16:17310854-17310876 TAATAATAATAAAGGAGAGAAGG + Intronic
1134829365 16:17310854-17310876 TAATAATAATAAAGGAGAGAAGG + Intronic
1135175000 16:20220118-20220140 GAATAGTAGTTTAGGAAAGATGG + Intergenic
1135175000 16:20220118-20220140 GAATAGTAGTTTAGGAAAGATGG + Intergenic
1135247716 16:20871339-20871361 CAAAAGTGCAAAAGAAAAGAGGG + Intronic
1135247716 16:20871339-20871361 CAAAAGTGCAAAAGAAAAGAGGG + Intronic
1135857374 16:26024363-26024385 CCACAGTTCTAAAGGGAAGATGG - Intronic
1135857374 16:26024363-26024385 CCACAGTTCTAAAGGGAAGATGG - Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137189651 16:37852055-37852077 CAATGGTAGAAAAGGAAATATGG + Intergenic
1137189651 16:37852055-37852077 CAATGGTAGAAAAGGAAATATGG + Intergenic
1137210602 16:38197845-38197867 CAATGGTAGAAAAGGAAATATGG + Intergenic
1137210602 16:38197845-38197867 CAATGGTAGAAAAGGAAATATGG + Intergenic
1138808094 16:60116148-60116170 CAATAAAAATAAAGGAAGGAAGG + Intergenic
1138808094 16:60116148-60116170 CAATAAAAATAAAGGAAGGAAGG + Intergenic
1141165758 16:81659872-81659894 CAATAGTAATAAAAGAATGCTGG - Intronic
1141165758 16:81659872-81659894 CAATAGTAATAAAAGAATGCTGG - Intronic
1142258341 16:89027820-89027842 AAATAGTACTATAGGCAAGCTGG - Intergenic
1142258341 16:89027820-89027842 AAATAGTACTATAGGCAAGCTGG - Intergenic
1143148547 17:4791971-4791993 CCATATTAATAAAGGAAAAATGG - Intergenic
1143148547 17:4791971-4791993 CCATATTAATAAAGGAAAAATGG - Intergenic
1145186175 17:20796205-20796227 GAAAAGTACTAAGGGAAACATGG - Intergenic
1145186175 17:20796205-20796227 GAAAAGTACTAAGGGAAACATGG - Intergenic
1148410949 17:47466639-47466661 CAAAAGTACTAAGGGAAACGTGG + Intergenic
1148410949 17:47466639-47466661 CAAAAGTACTAAGGGAAACGTGG + Intergenic
1149027549 17:52046360-52046382 CAACAGTACAAAGGGAAGGAAGG + Intronic
1149027549 17:52046360-52046382 CAACAGTACAAAGGGAAGGAAGG + Intronic
1149240005 17:54637992-54638014 GAATAGGATGAAAGGAAAGAAGG + Intergenic
1149240005 17:54637992-54638014 GAATAGGATGAAAGGAAAGAAGG + Intergenic
1151270161 17:72987903-72987925 CAAGAGTAATAATGGAAAGTAGG - Intronic
1151270161 17:72987903-72987925 CAAGAGTAATAATGGAAAGTAGG - Intronic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1153662689 18:7339495-7339517 CAATAGTATTTAAGGCAATATGG + Intergenic
1153662689 18:7339495-7339517 CAATAGTATTTAAGGCAATATGG + Intergenic
1153959251 18:10126879-10126901 CAATAGCACAAAAGGAGGGAAGG - Intergenic
1153959251 18:10126879-10126901 CAATAGCACAAAAGGAGGGAAGG - Intergenic
1156052734 18:32956950-32956972 AAATATTTCTAAAGGAAGGAAGG + Intronic
1156052734 18:32956950-32956972 AAATATTTCTAAAGGAAGGAAGG + Intronic
1156372154 18:36481155-36481177 CAACAGGACTGAAGGAAGGAGGG + Intronic
1156372154 18:36481155-36481177 CAACAGGACTGAAGGAAGGAGGG + Intronic
1156432966 18:37095653-37095675 CAACAGAACTAAATGAAATATGG + Intronic
1156432966 18:37095653-37095675 CAACAGAACTAAATGAAATATGG + Intronic
1156662628 18:39364488-39364510 AAATAGCACTTAAAGAAAGAAGG + Intergenic
1156662628 18:39364488-39364510 AAATAGCACTTAAAGAAAGAAGG + Intergenic
1158098436 18:53802296-53802318 TAATATTACTGAAAGAAAGAAGG - Intergenic
1158098436 18:53802296-53802318 TAATATTACTGAAAGAAAGAAGG - Intergenic
1158843482 18:61414415-61414437 CAAAAGAACTAAAGGAATTAGGG + Intronic
1158843482 18:61414415-61414437 CAAAAGAACTAAAGGAATTAGGG + Intronic
1159614100 18:70560273-70560295 GAATAGTACTACAGTAAACATGG - Intergenic
1159614100 18:70560273-70560295 GAATAGTACTACAGTAAACATGG - Intergenic
1159737340 18:72115776-72115798 AAATAGGAAGAAAGGAAAGAAGG - Intergenic
1159737340 18:72115776-72115798 AAATAGGAAGAAAGGAAAGAAGG - Intergenic
1159866057 18:73706399-73706421 CACTAGTAGTAAAGTAAATATGG + Intergenic
1159866057 18:73706399-73706421 CACTAGTAGTAAAGTAAATATGG + Intergenic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
925538230 2:4939003-4939025 CAATAATAATATAAGAAAGAAGG + Intergenic
925538230 2:4939003-4939025 CAATAATAATATAAGAAAGAAGG + Intergenic
929851942 2:45599472-45599494 CAATAGTACTAAAGAGGAGGTGG - Exonic
929851942 2:45599472-45599494 CAATAGTACTAAAGAGGAGGTGG - Exonic
930518535 2:52435380-52435402 CAAGGGTACTTAAGCAAAGAAGG + Intergenic
930518535 2:52435380-52435402 CAAGGGTACTTAAGCAAAGAAGG + Intergenic
931582813 2:63795677-63795699 CCATAGTAAAGAAGGAAAGAAGG + Intronic
931582813 2:63795677-63795699 CCATAGTAAAGAAGGAAAGAAGG + Intronic
931587624 2:63845432-63845454 CAACAGAACTAAAAGAAAAAAGG + Intronic
931587624 2:63845432-63845454 CAACAGAACTAAAAGAAAAAAGG + Intronic
933439169 2:82288525-82288547 CCATAATTCTAAAGGAAAGTAGG - Intergenic
933439169 2:82288525-82288547 CCATAATTCTAAAGGAAAGTAGG - Intergenic
933600105 2:84320221-84320243 CAAAGGGACTGAAGGAAAGATGG + Intergenic
933600105 2:84320221-84320243 CAAAGGGACTGAAGGAAAGATGG + Intergenic
934065308 2:88335211-88335233 TAAAAATACTAAAGGAAAGGAGG + Intergenic
934065308 2:88335211-88335233 TAAAAATACTAAAGGAAAGGAGG + Intergenic
938557970 2:132443297-132443319 CAATATTACTAAAGTACAGATGG + Intronic
938557970 2:132443297-132443319 CAATATTACTAAAGTACAGATGG + Intronic
939921245 2:148116611-148116633 CTATACTACTAAAGAAAAGGAGG - Intronic
939921245 2:148116611-148116633 CTATACTACTAAAGAAAAGGAGG - Intronic
941970479 2:171345200-171345222 CAATATTGCTGAGGGAAAGAAGG + Intronic
941970479 2:171345200-171345222 CAATATTGCTGAGGGAAAGAAGG + Intronic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
942704378 2:178753036-178753058 CAATAATACTAAGAGAAAGAAGG + Intronic
942704378 2:178753036-178753058 CAATAATACTAAGAGAAAGAAGG + Intronic
942794013 2:179794744-179794766 CAATCATAATAGAGGAAAGAGGG + Intronic
942794013 2:179794744-179794766 CAATCATAATAGAGGAAAGAGGG + Intronic
942906757 2:181191550-181191572 AAATAGAAATAAGGGAAAGAGGG + Intergenic
942906757 2:181191550-181191572 AAATAGAAATAAGGGAAAGAGGG + Intergenic
943679500 2:190753020-190753042 CAATAGTACTAGTGGAATGAGGG - Intergenic
943679500 2:190753020-190753042 CAATAGTACTAGTGGAATGAGGG - Intergenic
943716144 2:191154354-191154376 CAATGGTACCAAAGCAAAGGTGG - Intergenic
943716144 2:191154354-191154376 CAATGGTACCAAAGCAAAGGTGG - Intergenic
943979777 2:194533916-194533938 AAAAAGTACAAAAGGAAAAAAGG + Intergenic
943979777 2:194533916-194533938 AAAAAGTACAAAAGGAAAAAAGG + Intergenic
944036346 2:195298884-195298906 CAATAGCACTAAAACAATGAAGG + Intergenic
944036346 2:195298884-195298906 CAATAGCACTAAAACAATGAAGG + Intergenic
944475198 2:200096463-200096485 GAATAGGAAGAAAGGAAAGAAGG - Intergenic
944475198 2:200096463-200096485 GAATAGGAAGAAAGGAAAGAAGG - Intergenic
945796304 2:214368653-214368675 TAATAGTAATAGTGGAAAGAGGG - Intronic
945796304 2:214368653-214368675 TAATAGTAATAGTGGAAAGAGGG - Intronic
945883004 2:215345973-215345995 CCATAGAAATAGAGGAAAGAAGG + Intronic
945883004 2:215345973-215345995 CCATAGAAATAGAGGAAAGAAGG + Intronic
946053030 2:216880014-216880036 CCACAGGACCAAAGGAAAGATGG - Intergenic
946053030 2:216880014-216880036 CCACAGGACCAAAGGAAAGATGG - Intergenic
946119136 2:217493869-217493891 CTATGAAACTAAAGGAAAGATGG - Intronic
946119136 2:217493869-217493891 CTATGAAACTAAAGGAAAGATGG - Intronic
948953611 2:241271360-241271382 AACTAGAACTAAAGGAAGGAGGG + Intronic
948953611 2:241271360-241271382 AACTAGAACTAAAGGAAGGAGGG + Intronic
949038081 2:241828157-241828179 AAATAGTACTAAAGCGGAGAGGG + Intergenic
949038081 2:241828157-241828179 AAATAGTACTAAAGCGGAGAGGG + Intergenic
1172430452 20:34886658-34886680 AAATAGTACAAAAAGAAAAACGG - Intronic
1172430452 20:34886658-34886680 AAATAGTACAAAAAGAAAAACGG - Intronic
1173734420 20:45348950-45348972 CATAAATACTAAAGGAATGAGGG + Intergenic
1173734420 20:45348950-45348972 CATAAATACTAAAGGAATGAGGG + Intergenic
1175020217 20:55839065-55839087 CAAAAGAACTACAGGACAGATGG - Intergenic
1175020217 20:55839065-55839087 CAAAAGAACTACAGGACAGATGG - Intergenic
1175226395 20:57446678-57446700 CAAAAGGGATAAAGGAAAGATGG + Intergenic
1175226395 20:57446678-57446700 CAAAAGGGATAAAGGAAAGATGG + Intergenic
1177049593 21:16215692-16215714 CCTTCGTATTAAAGGAAAGAGGG - Intergenic
1177049593 21:16215692-16215714 CCTTCGTATTAAAGGAAAGAGGG - Intergenic
1177508721 21:22053730-22053752 CACTAGGACTAAAGGAAACACGG - Intergenic
1177508721 21:22053730-22053752 CACTAGGACTAAAGGAAACACGG - Intergenic
1178010437 21:28279321-28279343 GAATAGTACTAAAATAAACATGG - Intergenic
1178010437 21:28279321-28279343 GAATAGTACTAAAATAAACATGG - Intergenic
1178015815 21:28344901-28344923 CACTACAACTCAAGGAAAGAAGG + Intergenic
1178015815 21:28344901-28344923 CACTACAACTCAAGGAAAGAAGG + Intergenic
1178186740 21:30230682-30230704 CAATAATACTATATGAAAAATGG - Intergenic
1178186740 21:30230682-30230704 CAATAATACTATATGAAAAATGG - Intergenic
1179438115 21:41375826-41375848 CATTACTACTAGAGGAAAGGGGG + Intronic
1179438115 21:41375826-41375848 CATTACTACTAGAGGAAAGGGGG + Intronic
1180507175 22:16024132-16024154 CAAGACTACTAAAGAAAAAAAGG + Intergenic
1180507175 22:16024132-16024154 CAAGACTACTAAAGAAAAAAAGG + Intergenic
1181421961 22:22807273-22807295 AAACAGAACTAAAGGAAAGCAGG + Intronic
1181421961 22:22807273-22807295 AAACAGAACTAAAGGAAAGCAGG + Intronic
1184386247 22:44176473-44176495 CAACTGTACTCAAGGAATGATGG + Intronic
1184386247 22:44176473-44176495 CAACTGTACTCAAGGAATGATGG + Intronic
1184650100 22:45915728-45915750 CAAAAGTAGGAAAGGAAAGGGGG - Intergenic
1184650100 22:45915728-45915750 CAAAAGTAGGAAAGGAAAGGGGG - Intergenic
1185115194 22:48930253-48930275 CAATAGTGCTTAAGTATAGAAGG - Intergenic
1185115194 22:48930253-48930275 CAATAGTGCTTAAGTATAGAAGG - Intergenic
949379087 3:3424557-3424579 CAATAGTACAAAAGGTGAGGAGG + Intergenic
949379087 3:3424557-3424579 CAATAGTACAAAAGGTGAGGAGG + Intergenic
950390311 3:12691362-12691384 TAGGAGTACTAAAGGAAAGCCGG + Intergenic
950390311 3:12691362-12691384 TAGGAGTACTAAAGGAAAGCCGG + Intergenic
950950095 3:16989927-16989949 GAATAATAAGAAAGGAAAGAGGG + Intronic
950950095 3:16989927-16989949 GAATAATAAGAAAGGAAAGAGGG + Intronic
951896960 3:27618632-27618654 CAAGAGTAGTTAAGGAAAGATGG - Intergenic
951896960 3:27618632-27618654 CAAGAGTAGTTAAGGAAAGATGG - Intergenic
951942662 3:28097619-28097641 CAATAGTAAAAGAGGAAAGGAGG - Intergenic
951942662 3:28097619-28097641 CAATAGTAAAAGAGGAAAGGAGG - Intergenic
951977723 3:28531905-28531927 CAATAGTGCTGAAAGAAACATGG - Intronic
951977723 3:28531905-28531927 CAATAGTGCTGAAAGAAACATGG - Intronic
956256386 3:67287472-67287494 AAATAATATGAAAGGAAAGAGGG + Intergenic
956256386 3:67287472-67287494 AAATAATATGAAAGGAAAGAGGG + Intergenic
957004259 3:74925805-74925827 CAATAGTTCTAAAGCAAAATAGG - Intergenic
957004259 3:74925805-74925827 CAATAGTTCTAAAGCAAAATAGG - Intergenic
957496638 3:81000127-81000149 CAAAATTACTAAAGAAAACATGG - Intergenic
957496638 3:81000127-81000149 CAAAATTACTAAAGAAAACATGG - Intergenic
958539270 3:95449241-95449263 CAATACAAGTAGAGGAAAGAAGG - Intergenic
958539270 3:95449241-95449263 CAATACAAGTAGAGGAAAGAAGG - Intergenic
958916134 3:100052579-100052601 CAATGCTAGTATAGGAAAGAGGG + Intronic
958916134 3:100052579-100052601 CAATGCTAGTATAGGAAAGAGGG + Intronic
959000680 3:100960775-100960797 CAATAGTCAGCAAGGAAAGAGGG + Intronic
959000680 3:100960775-100960797 CAATAGTCAGCAAGGAAAGAGGG + Intronic
959471433 3:106756428-106756450 GAATAGTACTAAAATAAACATGG - Intergenic
959471433 3:106756428-106756450 GAATAGTACTAAAATAAACATGG - Intergenic
959943868 3:112107199-112107221 AAAGATTAATAAAGGAAAGAAGG + Intronic
959943868 3:112107199-112107221 AAAGATTAATAAAGGAAAGAAGG + Intronic
961852488 3:129835167-129835189 CAAGAGGATCAAAGGAAAGAGGG - Intronic
961852488 3:129835167-129835189 CAAGAGGATCAAAGGAAAGAGGG - Intronic
962129120 3:132653696-132653718 AAGTAGTATTAATGGAAAGAAGG - Intronic
962129120 3:132653696-132653718 AAGTAGTATTAATGGAAAGAAGG - Intronic
962166735 3:133057257-133057279 AAATAGTAAGAAGGGAAAGAAGG - Intronic
962166735 3:133057257-133057279 AAATAGTAAGAAGGGAAAGAAGG - Intronic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
963884331 3:150563778-150563800 ACTTAATACTAAAGGAAAGAAGG - Intronic
963884331 3:150563778-150563800 ACTTAATACTAAAGGAAAGAAGG - Intronic
965724026 3:171694886-171694908 AAATAATTCTAAAGGAAATAGGG + Intronic
965724026 3:171694886-171694908 AAATAATTCTAAAGGAAATAGGG + Intronic
966785017 3:183615567-183615589 CAAAAGAAAGAAAGGAAAGAAGG + Intergenic
966785017 3:183615567-183615589 CAAAAGAAAGAAAGGAAAGAAGG + Intergenic
967638137 3:191829767-191829789 GAATAGTACTACAGTAAACATGG - Intergenic
967638137 3:191829767-191829789 GAATAGTACTACAGTAAACATGG - Intergenic
968838972 4:2986792-2986814 CAATAGTACTAAAGGAAAGATGG - Intronic
968838972 4:2986792-2986814 CAATAGTACTAAAGGAAAGATGG - Intronic
970119031 4:12732043-12732065 GAATAGTAGGCAAGGAAAGAGGG + Intergenic
970119031 4:12732043-12732065 GAATAGTAGGCAAGGAAAGAGGG + Intergenic
971595980 4:28529452-28529474 CTAAAGTATTAAAGGAAAAAAGG - Intergenic
971595980 4:28529452-28529474 CTAAAGTATTAAAGGAAAAAAGG - Intergenic
971597178 4:28545431-28545453 CAATATTTCTAAAGGTGAGAAGG - Intergenic
971597178 4:28545431-28545453 CAATATTTCTAAAGGTGAGAAGG - Intergenic
972196872 4:36664347-36664369 ATATAGAACTAATGGAAAGAGGG + Intergenic
972196872 4:36664347-36664369 ATATAGAACTAATGGAAAGAGGG + Intergenic
974314490 4:60260755-60260777 CGATAGTACCAAATGAAAGGAGG - Intergenic
974314490 4:60260755-60260777 CGATAGTACCAAATGAAAGGAGG - Intergenic
974338649 4:60585517-60585539 AAATAAGACAAAAGGAAAGAAGG + Intergenic
974338649 4:60585517-60585539 AAATAAGACAAAAGGAAAGAAGG + Intergenic
974341587 4:60620469-60620491 GGATAGTGATAAAGGAAAGATGG + Intergenic
974341587 4:60620469-60620491 GGATAGTGATAAAGGAAAGATGG + Intergenic
974522584 4:63003324-63003346 AAATAGAACAAAAGGAAAAAGGG + Intergenic
974522584 4:63003324-63003346 AAATAGAACAAAAGGAAAAAGGG + Intergenic
975038827 4:69718931-69718953 CAATAGTTCTAGAGGAAGGGAGG + Intergenic
975038827 4:69718931-69718953 CAATAGTTCTAGAGGAAGGGAGG + Intergenic
976449199 4:85166957-85166979 CAAAAGTACTGAGGCAAAGATGG - Intergenic
976449199 4:85166957-85166979 CAAAAGTACTGAGGCAAAGATGG - Intergenic
976858760 4:89637359-89637381 CAACAGTCCTAAGAGAAAGAGGG + Intergenic
976858760 4:89637359-89637381 CAACAGTCCTAAGAGAAAGAGGG + Intergenic
976933879 4:90604107-90604129 CAATAGTTCACCAGGAAAGATGG - Intronic
976933879 4:90604107-90604129 CAATAGTTCACCAGGAAAGATGG - Intronic
978854562 4:113379722-113379744 ATATAGTATTAAAGGAAAAAGGG + Intronic
978854562 4:113379722-113379744 ATATAGTATTAAAGGAAAAAGGG + Intronic
979056743 4:116004342-116004364 CAATAATGCAAAATGAAAGAAGG + Intergenic
979056743 4:116004342-116004364 CAATAATGCAAAATGAAAGAAGG + Intergenic
979087061 4:116426811-116426833 TAAAAGTCCTAAAGAAAAGAAGG - Intergenic
979087061 4:116426811-116426833 TAAAAGTCCTAAAGAAAAGAAGG - Intergenic
979144423 4:117223955-117223977 TAATAGTTCTAAAGTAAATATGG - Intergenic
979144423 4:117223955-117223977 TAATAGTTCTAAAGTAAATATGG - Intergenic
979265605 4:118698556-118698578 TAATAGTAGGAATGGAAAGAAGG + Intronic
979265605 4:118698556-118698578 TAATAGTAGGAATGGAAAGAAGG + Intronic
980338818 4:131514154-131514176 CAATAGCACTAAAGCAAAAATGG - Intergenic
980338818 4:131514154-131514176 CAATAGCACTAAAGCAAAAATGG - Intergenic
980834323 4:138172727-138172749 CAATGGTTCTGAAGGAAAAAAGG - Intronic
980834323 4:138172727-138172749 CAATGGTTCTGAAGGAAAAAAGG - Intronic
981064929 4:140473158-140473180 AAATAGGAATGAAGGAAAGAAGG - Intronic
981064929 4:140473158-140473180 AAATAGGAATGAAGGAAAGAAGG - Intronic
981065996 4:140486339-140486361 AAATAATAATAAGGGAAAGACGG - Intronic
981065996 4:140486339-140486361 AAATAATAATAAGGGAAAGACGG - Intronic
981680349 4:147390338-147390360 CAATAAGAATAAAGGGAAGAAGG + Intergenic
981680349 4:147390338-147390360 CAATAAGAATAAAGGGAAGAAGG + Intergenic
982524788 4:156465233-156465255 CATTAGTACTAAAGAGAAAAAGG + Intergenic
982524788 4:156465233-156465255 CATTAGTACTAAAGAGAAAAAGG + Intergenic
983123402 4:163917119-163917141 GCATATTACTAAATGAAAGAAGG - Intronic
983123402 4:163917119-163917141 GCATATTACTAAATGAAAGAAGG - Intronic
986615600 5:9614002-9614024 CAACACTGCTAGAGGAAAGATGG + Intergenic
986615600 5:9614002-9614024 CAACACTGCTAGAGGAAAGATGG + Intergenic
987563300 5:19552252-19552274 AAATATTACTCAATGAAAGAGGG - Intronic
987563300 5:19552252-19552274 AAATATTACTCAATGAAAGAGGG - Intronic
990272725 5:54161909-54161931 CAATAGTAATAAAGGTAACTTGG - Intronic
990272725 5:54161909-54161931 CAATAGTAATAAAGGTAACTTGG - Intronic
990799468 5:59584150-59584172 CAGTAGGACAAAGGGAAAGAGGG + Intronic
990799468 5:59584150-59584172 CAGTAGGACAAAGGGAAAGAGGG + Intronic
990921143 5:60969153-60969175 GAATAGTACTACAGTAAACATGG + Intronic
990921143 5:60969153-60969175 GAATAGTACTACAGTAAACATGG + Intronic
991068380 5:62448916-62448938 CAATAGCATTAAAGACAAGAGGG - Intronic
991068380 5:62448916-62448938 CAATAGCATTAAAGACAAGAGGG - Intronic
991122149 5:63029043-63029065 CAATCCTAGTAAAAGAAAGAGGG + Intergenic
991122149 5:63029043-63029065 CAATCCTAGTAAAAGAAAGAGGG + Intergenic
991557215 5:67909123-67909145 CAATCTTAGTAAAGGAAAAAAGG + Intergenic
991557215 5:67909123-67909145 CAATCTTAGTAAAGGAAAAAAGG + Intergenic
991595170 5:68296901-68296923 AAATAGTCCTACAGCAAAGAAGG + Intronic
991595170 5:68296901-68296923 AAATAGTCCTACAGCAAAGAAGG + Intronic
992058857 5:73021462-73021484 CTAAAGTACTAAAGGAAAAAAGG - Intronic
992058857 5:73021462-73021484 CTAAAGTACTAAAGGAAAAAAGG - Intronic
992283702 5:75209952-75209974 CAATAGTGCTAAAGTAATGGTGG - Intronic
992283702 5:75209952-75209974 CAATAGTGCTAAAGTAATGGTGG - Intronic
992558488 5:77927360-77927382 CCTTATTGCTAAAGGAAAGAGGG - Intergenic
992558488 5:77927360-77927382 CCTTATTGCTAAAGGAAAGAGGG - Intergenic
993024666 5:82631698-82631720 CAATAGCACAAAAGAGAAGAGGG + Intergenic
993024666 5:82631698-82631720 CAATAGCACAAAAGAGAAGAGGG + Intergenic
994704746 5:103188953-103188975 CAATATTAAAAAAGGAAAAAAGG - Intronic
994704746 5:103188953-103188975 CAATATTAAAAAAGGAAAAAAGG - Intronic
994748679 5:103711201-103711223 AAATAGAACTAAAGAAAGGAAGG - Intergenic
994748679 5:103711201-103711223 AAATAGAACTAAAGAAAGGAAGG - Intergenic
994927351 5:106134244-106134266 CAATAGAAGAAAAAGAAAGAAGG - Intergenic
994927351 5:106134244-106134266 CAATAGAAGAAAAAGAAAGAAGG - Intergenic
996233890 5:121103529-121103551 ATACAGTACAAAAGGAAAGATGG - Intergenic
996233890 5:121103529-121103551 ATACAGTACAAAAGGAAAGATGG - Intergenic
997010020 5:129865767-129865789 TAATAATAATAAAGGAAGGAAGG + Intergenic
997010020 5:129865767-129865789 TAATAATAATAAAGGAAGGAAGG + Intergenic
997351458 5:133234223-133234245 AAATAGAACTAAAGGGAAAATGG + Intronic
997351458 5:133234223-133234245 AAATAGAACTAAAGGGAAAATGG + Intronic
998016762 5:138738357-138738379 AAATAGTTTTAAAGGAGAGAGGG - Intronic
998016762 5:138738357-138738379 AAATAGTTTTAAAGGAGAGAGGG - Intronic
999550495 5:152681457-152681479 AATTAGTAGTAAAGGAAACAAGG + Intergenic
999550495 5:152681457-152681479 AATTAGTAGTAAAGGAAACAAGG + Intergenic
1003216616 6:4119086-4119108 CCATATTACCAAGGGAAAGAAGG + Intronic
1003216616 6:4119086-4119108 CCATATTACCAAGGGAAAGAAGG + Intronic
1003840904 6:10118448-10118470 CAAGATGCCTAAAGGAAAGAAGG + Intronic
1003840904 6:10118448-10118470 CAAGATGCCTAAAGGAAAGAAGG + Intronic
1003858884 6:10303761-10303783 CATTTGTACTAAAGGAACAATGG - Intergenic
1003858884 6:10303761-10303783 CATTTGTACTAAAGGAACAATGG - Intergenic
1008203650 6:48625507-48625529 CAATAGTGCAATAGGAAATATGG - Intergenic
1008203650 6:48625507-48625529 CAATAGTGCAATAGGAAATATGG - Intergenic
1008858252 6:56117012-56117034 CAATAGGAATGAAAGAAAGAAGG + Intronic
1008858252 6:56117012-56117034 CAATAGGAATGAAAGAAAGAAGG + Intronic
1009381400 6:63035036-63035058 CATTAATACTGAATGAAAGAAGG + Intergenic
1009381400 6:63035036-63035058 CATTAATACTGAATGAAAGAAGG + Intergenic
1010041095 6:71384702-71384724 CTATAGCACCAAAGGATAGACGG + Intergenic
1010041095 6:71384702-71384724 CTATAGCACCAAAGGATAGACGG + Intergenic
1010292720 6:74157059-74157081 GAATATTTTTAAAGGAAAGATGG + Intergenic
1010292720 6:74157059-74157081 GAATATTTTTAAAGGAAAGATGG + Intergenic
1010631642 6:78205786-78205808 AAATAGTATTAAATGAAAGAAGG + Intergenic
1010631642 6:78205786-78205808 AAATAGTATTAAATGAAAGAAGG + Intergenic
1011266509 6:85525295-85525317 CAATAGTACTAGTAGAAATAAGG + Intronic
1011266509 6:85525295-85525317 CAATAGTACTAGTAGAAATAAGG + Intronic
1011713015 6:90073921-90073943 CAATATTACTCAAAGAAAAAAGG + Intronic
1011713015 6:90073921-90073943 CAATATTACTCAAAGAAAAAAGG + Intronic
1012056136 6:94413322-94413344 CAAAGATACTAAATGAAAGAGGG - Intergenic
1012056136 6:94413322-94413344 CAAAGATACTAAATGAAAGAGGG - Intergenic
1013757635 6:113480263-113480285 CAATAGGAATAAAGGGGAGATGG + Intergenic
1013757635 6:113480263-113480285 CAATAGGAATAAAGGGGAGATGG + Intergenic
1014012663 6:116494159-116494181 CAATAGGCATAAAGGAAATAGGG - Intergenic
1014012663 6:116494159-116494181 CAATAGGCATAAAGGAAATAGGG - Intergenic
1014060334 6:117064327-117064349 CACTAATAATAATGGAAAGATGG - Intergenic
1014060334 6:117064327-117064349 CACTAATAATAATGGAAAGATGG - Intergenic
1014471915 6:121826437-121826459 CAATACTTTTAAAAGAAAGAGGG + Intergenic
1014471915 6:121826437-121826459 CAATACTTTTAAAAGAAAGAGGG + Intergenic
1015191091 6:130473110-130473132 CAATAGTCCAGAAGGAAACAGGG + Intergenic
1015191091 6:130473110-130473132 CAATAGTCCAGAAGGAAACAGGG + Intergenic
1017013861 6:150084280-150084302 CAGTAGTTCTAAAGGCAGGATGG + Intergenic
1017013861 6:150084280-150084302 CAGTAGTTCTAAAGGCAGGATGG + Intergenic
1017076952 6:150627807-150627829 CACTAGTGCTCAAGGCAAGAGGG - Intronic
1017076952 6:150627807-150627829 CACTAGTGCTCAAGGCAAGAGGG - Intronic
1017560960 6:155627665-155627687 CAAAAGAAATAAAGGAAGGAAGG + Intergenic
1017560960 6:155627665-155627687 CAAAAGAAATAAAGGAAGGAAGG + Intergenic
1018566237 6:165156969-165156991 TAAGAGAACTAAAGCAAAGAAGG - Intergenic
1018566237 6:165156969-165156991 TAAGAGAACTAAAGCAAAGAAGG - Intergenic
1018814818 6:167322759-167322781 AAACAGTACTGAAGTAAAGATGG + Intergenic
1018814818 6:167322759-167322781 AAACAGTACTGAAGTAAAGATGG + Intergenic
1021590998 7:22261786-22261808 CAAAGGTGCAAAAGGAAAGATGG + Intronic
1021590998 7:22261786-22261808 CAAAGGTGCAAAAGGAAAGATGG + Intronic
1022652777 7:32292781-32292803 GAATAGTAATGAAGGAATGACGG - Intronic
1022652777 7:32292781-32292803 GAATAGTAATGAAGGAATGACGG - Intronic
1022661291 7:32369687-32369709 GAATAGTACTACAGTAAACATGG - Intergenic
1022661291 7:32369687-32369709 GAATAGTACTACAGTAAACATGG - Intergenic
1022778983 7:33558970-33558992 CAATTGTACTTAGGGGAAGAAGG - Intronic
1022778983 7:33558970-33558992 CAATTGTACTTAGGGGAAGAAGG - Intronic
1023300721 7:38768043-38768065 CTATCATACTAAAGGAAATAGGG + Intronic
1023300721 7:38768043-38768065 CTATCATACTAAAGGAAATAGGG + Intronic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1026928727 7:74211068-74211090 AAATAGCACTAAAGGGAAGTGGG - Intronic
1026928727 7:74211068-74211090 AAATAGCACTAAAGGGAAGTGGG - Intronic
1026994635 7:74607399-74607421 CAAAAGTAATAAATGAAGGACGG + Intergenic
1026994635 7:74607399-74607421 CAAAAGTAATAAATGAAGGACGG + Intergenic
1027231189 7:76273547-76273569 CAATAATAAAAAAGAAAAGAAGG - Intronic
1027231189 7:76273547-76273569 CAATAATAAAAAAGAAAAGAAGG - Intronic
1028249277 7:88521844-88521866 GTATAGTACTGAAGGAAATATGG + Intergenic
1028249277 7:88521844-88521866 GTATAGTACTGAAGGAAATATGG + Intergenic
1028363995 7:90005759-90005781 CAATATTATTAAATGAAATAGGG - Intergenic
1028363995 7:90005759-90005781 CAATATTATTAAATGAAATAGGG - Intergenic
1028788897 7:94830865-94830887 CATTAGCACTAAGGGAAAAATGG - Intergenic
1028788897 7:94830865-94830887 CATTAGCACTAAGGGAAAAATGG - Intergenic
1029054690 7:97729622-97729644 CATTATTAATATAGGAAAGATGG - Intergenic
1029054690 7:97729622-97729644 CATTATTAATATAGGAAAGATGG - Intergenic
1030717080 7:112821463-112821485 CAATAGCACTAAAGAGAAAAAGG + Exonic
1030717080 7:112821463-112821485 CAATAGCACTAAAGAGAAAAAGG + Exonic
1031611038 7:123827476-123827498 CAATTGAAGCAAAGGAAAGAAGG - Intergenic
1031611038 7:123827476-123827498 CAATTGAAGCAAAGGAAAGAAGG - Intergenic
1031763147 7:125739536-125739558 GCATAGTACTAAATGAAAGAAGG - Intergenic
1031763147 7:125739536-125739558 GCATAGTACTAAATGAAAGAAGG - Intergenic
1032955803 7:136970877-136970899 CAATGGAACTGAAGGAAAAATGG - Intronic
1032955803 7:136970877-136970899 CAATGGAACTGAAGGAAAAATGG - Intronic
1033545998 7:142400597-142400619 CCATTTTACAAAAGGAAAGAGGG - Intergenic
1033545998 7:142400597-142400619 CCATTTTACAAAAGGAAAGAGGG - Intergenic
1034614193 7:152400864-152400886 AAATAGGACTAAGGGAAAGCAGG + Intronic
1034614193 7:152400864-152400886 AAATAGGACTAAGGGAAAGCAGG + Intronic
1036079305 8:5536756-5536778 CAACAGTAATAAAGGCAATAAGG + Intergenic
1036079305 8:5536756-5536778 CAACAGTAATAAAGGCAATAAGG + Intergenic
1036396077 8:8372366-8372388 CAAAAATACTTCAGGAAAGAAGG - Intronic
1036396077 8:8372366-8372388 CAAAAATACTTCAGGAAAGAAGG - Intronic
1036439442 8:8767338-8767360 CAATAATAATAAGAGAAAGATGG - Intergenic
1036439442 8:8767338-8767360 CAATAATAATAAGAGAAAGATGG - Intergenic
1038819225 8:30936996-30937018 AAAGAGTCCTAAAGGGAAGAGGG + Intergenic
1038819225 8:30936996-30937018 AAAGAGTCCTAAAGGGAAGAGGG + Intergenic
1039412213 8:37364600-37364622 CAATATTATTAAAGGAACCATGG + Intergenic
1039412213 8:37364600-37364622 CAATATTATTAAAGGAACCATGG + Intergenic
1041078881 8:54195630-54195652 GAATAGTACTGAAGTAAACATGG + Intergenic
1041078881 8:54195630-54195652 GAATAGTACTGAAGTAAACATGG + Intergenic
1041990490 8:63984119-63984141 CTAAAGTATTAAAGGAAAGAAGG - Intergenic
1041990490 8:63984119-63984141 CTAAAGTATTAAAGGAAAGAAGG - Intergenic
1042880999 8:73489023-73489045 GAATAGTTTTAAAGAAAAGATGG + Intronic
1042880999 8:73489023-73489045 GAATAGTTTTAAAGAAAAGATGG + Intronic
1044108097 8:88237190-88237212 CAACAGTATTAAAGGTAAAAGGG + Intronic
1044108097 8:88237190-88237212 CAACAGTATTAAAGGTAAAAGGG + Intronic
1044255291 8:90053162-90053184 GATTAGTACTAAAGGTAAAATGG - Intergenic
1044255291 8:90053162-90053184 GATTAGTACTAAAGGTAAAATGG - Intergenic
1044463776 8:92480088-92480110 TAATAGTGCTAAAAGAAAGAAGG - Intergenic
1044463776 8:92480088-92480110 TAATAGTGCTAAAAGAAAGAAGG - Intergenic
1044479617 8:92670183-92670205 AAATAGAAATACAGGAAAGATGG - Intergenic
1044479617 8:92670183-92670205 AAATAGAAATACAGGAAAGATGG - Intergenic
1046465457 8:114596390-114596412 CAATAATAGTAAATGTAAGAAGG - Intergenic
1046465457 8:114596390-114596412 CAATAATAGTAAATGTAAGAAGG - Intergenic
1046581522 8:116099036-116099058 CAATATTAGTCAATGAAAGAAGG + Intergenic
1046581522 8:116099036-116099058 CAATATTAGTCAATGAAAGAAGG + Intergenic
1046597501 8:116278100-116278122 CAACTGTAGTAAATGAAAGAGGG + Intergenic
1046597501 8:116278100-116278122 CAACTGTAGTAAATGAAAGAGGG + Intergenic
1049520987 8:143090759-143090781 CAAAAGTACACAAGGAAGGAAGG + Intergenic
1049520987 8:143090759-143090781 CAAAAGTACACAAGGAAGGAAGG + Intergenic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1050257146 9:3806584-3806606 CTAAAGTAATAAAGGAAAGGAGG - Intergenic
1050257146 9:3806584-3806606 CTAAAGTAATAAAGGAAAGGAGG - Intergenic
1050415524 9:5412672-5412694 CAAAAGTACCACAGGAAACAAGG + Intronic
1050415524 9:5412672-5412694 CAAAAGTACCACAGGAAACAAGG + Intronic
1051803066 9:20958979-20959001 GAATAGTACTAAAATAAACATGG + Intronic
1051803066 9:20958979-20959001 GAATAGTACTAAAATAAACATGG + Intronic
1051848169 9:21476412-21476434 ATATAGCATTAAAGGAAAGAAGG - Intergenic
1051848169 9:21476412-21476434 ATATAGCATTAAAGGAAAGAAGG - Intergenic
1055884430 9:81043820-81043842 CAAAGGGAGTAAAGGAAAGATGG + Intergenic
1055884430 9:81043820-81043842 CAAAGGGAGTAAAGGAAAGATGG + Intergenic
1056432890 9:86546278-86546300 CAATTGTTCTAAAGGAGAGTTGG - Intergenic
1056432890 9:86546278-86546300 CAATTGTTCTAAAGGAGAGTTGG - Intergenic
1056438267 9:86594718-86594740 CAGGAGAACTTAAGGAAAGATGG - Intergenic
1056438267 9:86594718-86594740 CAGGAGAACTTAAGGAAAGATGG - Intergenic
1058212599 9:102188879-102188901 CTATATTACTAAAGGCAAAAGGG - Intergenic
1058212599 9:102188879-102188901 CTATATTACTAAAGGCAAAAGGG - Intergenic
1058844965 9:108947713-108947735 CATGAATACTGAAGGAAAGAAGG + Intronic
1058844965 9:108947713-108947735 CATGAATACTGAAGGAAAGAAGG + Intronic
1059198921 9:112396627-112396649 CACTACTACTAAAGGAATCACGG - Intronic
1059198921 9:112396627-112396649 CACTACTACTAAAGGAATCACGG - Intronic
1060042882 9:120316012-120316034 CCATAGTAGTTTAGGAAAGAAGG + Intergenic
1060042882 9:120316012-120316034 CCATAGTAGTTTAGGAAAGAAGG + Intergenic
1060126377 9:121051485-121051507 AAATAGTACTAAAAAAGAGAAGG - Intergenic
1060126377 9:121051485-121051507 AAATAGTACTAAAAAAGAGAAGG - Intergenic
1186678237 X:11843377-11843399 CACTAATAGTAAAGAAAAGAGGG - Intergenic
1186678237 X:11843377-11843399 CACTAATAGTAAAGAAAAGAGGG - Intergenic
1187225379 X:17371254-17371276 CAGCAAAACTAAAGGAAAGAGGG + Intergenic
1187225379 X:17371254-17371276 CAGCAAAACTAAAGGAAAGAGGG + Intergenic
1188124210 X:26347893-26347915 CAATAGTCAAGAAGGAAAGATGG - Intergenic
1188124210 X:26347893-26347915 CAATAGTCAAGAAGGAAAGATGG - Intergenic
1188534636 X:31182936-31182958 CAAAAGGATGAAAGGAAAGAAGG + Intronic
1188534636 X:31182936-31182958 CAAAAGGATGAAAGGAAAGAAGG + Intronic
1189481553 X:41395880-41395902 TAATAGTAACAAAGGAAGGATGG - Intergenic
1189481553 X:41395880-41395902 TAATAGTAACAAAGGAAGGATGG - Intergenic
1192046615 X:67681943-67681965 CAATAGTATTAACAGAATGAAGG + Intronic
1192046615 X:67681943-67681965 CAATAGTATTAACAGAATGAAGG + Intronic
1193846422 X:86477737-86477759 AAACAGAAATAAAGGAAAGAAGG - Intronic
1193846422 X:86477737-86477759 AAACAGAAATAAAGGAAAGAAGG - Intronic
1194502249 X:94696102-94696124 AAATAGTACAAAAAGGAAGAAGG + Intergenic
1194502249 X:94696102-94696124 AAATAGTACAAAAAGGAAGAAGG + Intergenic
1194737759 X:97533741-97533763 CAATAGTAGTTAAGGCTAGAGGG - Intronic
1194737759 X:97533741-97533763 CAATAGTAGTTAAGGCTAGAGGG - Intronic
1194869369 X:99109208-99109230 CAATAGTAATAAAACAAAAATGG + Intergenic
1194869369 X:99109208-99109230 CAATAGTAATAAAACAAAAATGG + Intergenic
1196390276 X:115200288-115200310 CAGTAGAACTAAATGAAATAGGG + Intronic
1196390276 X:115200288-115200310 CAGTAGAACTAAATGAAATAGGG + Intronic
1196821727 X:119706627-119706649 TAATAATAATAAAAGAAAGATGG + Intergenic
1196821727 X:119706627-119706649 TAATAATAATAAAAGAAAGATGG + Intergenic
1202577449 Y:26342779-26342801 CAAGACTAATAAAGAAAAGAAGG + Intergenic
1202577449 Y:26342779-26342801 CAAGACTAATAAAGAAAAGAAGG + Intergenic