ID: 968839034

View in Genome Browser
Species Human (GRCh38)
Location 4:2987638-2987660
Sequence GTACTCAGAAGCAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 670}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968839032_968839034 13 Left 968839032 4:2987602-2987624 CCTGTTTGAGTCCGTGCTTTCAC 0: 1
1: 0
2: 13
3: 64
4: 167
Right 968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG 0: 1
1: 0
2: 12
3: 93
4: 670
968839033_968839034 2 Left 968839033 4:2987613-2987635 CCGTGCTTTCACTTGTTTTGTGT 0: 1
1: 0
2: 67
3: 407
4: 1475
Right 968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG 0: 1
1: 0
2: 12
3: 93
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968839034 Original CRISPR GTACTCAGAAGCAGAATTGT TGG Intronic
900887689 1:5427138-5427160 CGTCCCAGAAGCAGAATTGTTGG + Intergenic
902106747 1:14043444-14043466 GTACCCAGAAGTGGAATTGCTGG + Intergenic
902120761 1:14163521-14163543 GCACTAAGAAGCAAAATGGTGGG - Intergenic
902702482 1:18181993-18182015 GTACTCAGATTCAGAACTCTGGG + Intronic
903254412 1:22084185-22084207 ATACCCAGAAGTGGAATTGTTGG + Intronic
903290018 1:22304866-22304888 GTTCTCAGAAGTGGAATTGCTGG - Intergenic
903537930 1:24079720-24079742 AATCTCAGAAGCAGAATTGCTGG + Intronic
903595116 1:24488108-24488130 TAACTCAGAAGAAGAATTGCTGG - Intergenic
903944531 1:26953395-26953417 GTACCCAGAAGTGGAATTGCTGG - Intronic
903955912 1:27025472-27025494 ATACTCAGGAGTAGAAATGTTGG + Intergenic
904315624 1:29658723-29658745 GTACCCAGAAGTGGAATTGCAGG + Intergenic
904333104 1:29778438-29778460 ATACCCAGAAGTAGAAGTGTTGG + Intergenic
905147518 1:35899400-35899422 ATACCCAGAAGCAGAATTGCTGG + Intronic
905888770 1:41506991-41507013 CAACACAGAAGCAGAATTGGTGG + Exonic
906578602 1:46914679-46914701 ATACTTAGTAGCAGTATTGTGGG + Intergenic
907147508 1:52248776-52248798 ATACCCAGAAGTAGAATTGCTGG + Intronic
907279315 1:53335328-53335350 ATACTCAGAAGTGGAATTGCTGG + Intergenic
907777858 1:57536396-57536418 GTCCTCAGAAGCATCACTGTGGG - Intronic
908771440 1:67600532-67600554 ATACCCAGAAGTAGAATTGCTGG + Intergenic
909098510 1:71320380-71320402 GTACCCAGAAGTGGAATTGCTGG + Intergenic
909649793 1:77961226-77961248 CTACTCAGAAGGAGCATTTTAGG - Intronic
911385891 1:97175071-97175093 ATACCTAGAAGTAGAATTGTTGG + Intronic
911399380 1:97355941-97355963 ATACCCAGAAGTAGGATTGTTGG + Intronic
911664433 1:100538153-100538175 GTGCTCAGAAGCAGGAGTGGTGG - Exonic
911684003 1:100752847-100752869 ATACCCAGAAGTAGAATTGCTGG + Intergenic
911747168 1:101452743-101452765 GTACTAAGAGGCAAAATGGTGGG + Intergenic
911977902 1:104525116-104525138 GTACCCAGAAGTGGAATTGTTGG - Intergenic
912016961 1:105050941-105050963 ACACTCAGTAGTAGAATTGTTGG - Intergenic
912030145 1:105230501-105230523 ATACTCAGAAATGGAATTGTTGG - Intergenic
912800603 1:112717494-112717516 GTATGAAGAAGCAGACTTGTGGG + Intergenic
913541407 1:119824580-119824602 ATACCCAGAAGTAGAATTGCTGG - Intergenic
914690668 1:150023269-150023291 GTACTCAGAAGTTGAATTGCTGG - Intergenic
914724418 1:150315755-150315777 ATACCCAGAAGTAGAATTGCTGG + Intergenic
915628589 1:157134304-157134326 ATACTCAGAGCAAGAATTGTTGG - Intronic
915638338 1:157202144-157202166 GTACCCAGAAGTGGGATTGTTGG + Intergenic
915658131 1:157378533-157378555 ATACCCAGAAGCAGGATTGCTGG - Intergenic
915711234 1:157900849-157900871 GTACCCAGAAATGGAATTGTTGG + Intergenic
916196743 1:162231001-162231023 ATACCCAGAAGTAGAATTGCTGG + Intronic
916371363 1:164099031-164099053 ATACACAGAAGTACAATTGTTGG + Intergenic
916643491 1:166757876-166757898 ATACTCAGGAGTAGAATTGCTGG + Intergenic
916714364 1:167436957-167436979 ATACCCAGAAGCGGGATTGTTGG - Intronic
917314712 1:173712601-173712623 GCACGCAGAAGCAAAATTGCTGG - Intergenic
917563370 1:176183583-176183605 ATACTCAGAAGTGGAATTGCTGG - Intronic
918174462 1:182030332-182030354 TTACTGGGAAGCAGAATTGGTGG + Intergenic
919259064 1:195166227-195166249 GAACACTGAAGCTGAATTGTGGG - Intergenic
919671320 1:200340560-200340582 GCACTGATAATCAGAATTGTGGG + Intergenic
919848326 1:201655543-201655565 GTCCCCAGAAGCAGCAGTGTGGG - Intronic
921347465 1:214201582-214201604 ATACTCAGAAGTAGAATTGCTGG - Intergenic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
921921756 1:220677497-220677519 ATACCCAGAAGTAGAATTGCTGG - Intergenic
922463796 1:225832561-225832583 ATACTCAGAAGTGGACTTGTTGG + Intronic
922559334 1:226557491-226557513 ATACCCAGAAGTAGGATTGTGGG + Intronic
923368715 1:233289026-233289048 GTCTTCACAAGCAAAATTGTGGG - Intronic
923415357 1:233752014-233752036 ATACCGAGAAGTAGAATTGTTGG + Intergenic
924878883 1:248136739-248136761 GTACCCAGAAGTGAAATTGTTGG - Intergenic
1063503541 10:6576187-6576209 GTACCCAGCAGTAGAATTGTGGG - Intronic
1063555978 10:7080239-7080261 ATATTCAGAAGTGGAATTGTAGG + Intergenic
1063782026 10:9336050-9336072 GAACCCAGAAGTAGAATTGCTGG - Intergenic
1063810929 10:9706600-9706622 ATACCCAGAAGTAAAATTGTTGG - Intergenic
1063862025 10:10321043-10321065 GTACTCAGAAGTGGATTTGCTGG - Intergenic
1063910790 10:10828138-10828160 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1064482958 10:15757859-15757881 ATACTAAGAAGCACGATTGTTGG + Intergenic
1064500311 10:15964420-15964442 GTACTCAGAAGCACAGGTGGTGG + Intergenic
1065167771 10:22998593-22998615 ATACTTAGAAACAGAATTGCTGG - Intronic
1065405729 10:25361446-25361468 ATACTCAGAAGTAGAATTGCAGG + Intronic
1065764825 10:29018658-29018680 ATGCCCAGAAGCAGAATTGCTGG - Intergenic
1066163771 10:32763462-32763484 GTACCCAGAAGGGGAATTGCTGG - Intronic
1066333244 10:34447965-34447987 ATATGCAGAAGCAGAATTGCTGG - Intronic
1066431917 10:35360121-35360143 GTACTCAGAAGTGGAATTGCTGG + Intronic
1066668066 10:37806217-37806239 ATACTCAGAAGTGGAATTGCTGG + Intronic
1067052912 10:43034521-43034543 ATACCCAGAAGCAGAATTGCTGG - Intergenic
1067152832 10:43750782-43750804 GTACCCAGAAGTGGAATTGTTGG + Intergenic
1067194548 10:44104880-44104902 ATATTCAGAAGCAGTATTGCTGG - Intergenic
1067413537 10:46085831-46085853 ATACCTAGAAGCAGAATTGTGGG + Intergenic
1068465110 10:57379780-57379802 GTACTCAGCAGCAGGGTTGCTGG - Intergenic
1069021960 10:63499228-63499250 ATACTCAGAAGCAGGATTGCTGG + Intergenic
1069380582 10:67840064-67840086 TTACCCAGAAGTGGAATTGTGGG - Intergenic
1070254169 10:74799757-74799779 ATACACAGAAGTAGAATTGCTGG - Intergenic
1070405444 10:76090509-76090531 ACACTCAGAAGCAGAATTGCCGG - Intronic
1070960161 10:80493385-80493407 ATACCCAGAAGTGGAATTGTTGG - Intronic
1071738130 10:88325156-88325178 ATACTCAGAAGTGGAATTGCTGG + Intronic
1071973574 10:90932348-90932370 ACACCCAGAAGCGGAATTGTTGG - Intergenic
1072628582 10:97130242-97130264 GTACCCAGAAGTGGAATTGCTGG - Intronic
1072712946 10:97729634-97729656 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1073082172 10:100867159-100867181 GTGCTCTGAAGCAGAGTTGGGGG - Intergenic
1073222268 10:101885261-101885283 ATACTCAGAAGTGGAATTGCTGG - Intronic
1073620093 10:105037635-105037657 GTTCTCATAAGGAGAAATGTAGG - Intronic
1074018503 10:109560308-109560330 GGGCTCAGAAGAAGAGTTGTAGG - Intergenic
1074659084 10:115630491-115630513 ATACCCAGAAGTAGATTTGTTGG - Intronic
1074909076 10:117891033-117891055 GTACTCAGACGCAAACGTGTGGG + Intergenic
1075308380 10:121389530-121389552 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1075415595 10:122260307-122260329 ATACCCAGAAGCAGGGTTGTTGG + Intergenic
1075510962 10:123072859-123072881 TTTCTCAGAAGCAGAAGTGGAGG + Intergenic
1075525351 10:123180262-123180284 ATACCCAGAGGCAGAATTGCTGG - Intergenic
1076382249 10:130032231-130032253 ATACCCAGAAGTGGAATTGTTGG + Intergenic
1076436495 10:130448563-130448585 ATACCCAGAAGGAGAATTGCTGG + Intergenic
1077937723 11:6806767-6806789 ATACTCAGTAATAGAATTGTTGG + Intergenic
1078166042 11:8886233-8886255 GTACTCAGAAGAATATTTCTAGG - Intronic
1078300527 11:10126663-10126685 ATACCCAGAAGTAAAATTGTTGG - Intronic
1078410280 11:11109288-11109310 GTACCCAGAAGTGGAATTTTTGG + Intergenic
1078695891 11:13631171-13631193 ATACTTAGAAGTGGAATTGTTGG + Intergenic
1079474082 11:20809873-20809895 GTACTCAGTAGCGGGATTGCCGG + Intronic
1079625508 11:22612147-22612169 GTACTCAGCAGTTGAATTGCTGG + Intergenic
1080223253 11:29931609-29931631 ATAACCAGAAGTAGAATTGTTGG - Intergenic
1080276413 11:30507929-30507951 GTTCCAAGAAGCAGAATTGGAGG + Intronic
1083286715 11:61664321-61664343 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1084294513 11:68202936-68202958 ATACCCAGAAGTAGAATTGCCGG + Intronic
1084357288 11:68648401-68648423 GGACCCAGAAGCAGAGGTGTGGG - Intergenic
1084496619 11:69508672-69508694 ATACTTAGAAGCGGAATTGCTGG + Intergenic
1084852337 11:71951951-71951973 ATACCTAGAAGCAGAATTGCTGG - Intronic
1084870143 11:72093179-72093201 AAACTAAGAACCAGAATTGTTGG - Intronic
1086297162 11:85382960-85382982 ATACTGAGGAGCAGAATTGCTGG - Intronic
1086614114 11:88794182-88794204 GTCCCCTGAAGCAGAATAGTGGG - Intronic
1087442051 11:98198116-98198138 TTACTCAGAAGAAGAAATGATGG + Intergenic
1087476791 11:98646179-98646201 GTATTTTGAAGCAGAAATGTTGG + Intergenic
1087578358 11:100019699-100019721 ATACTCAGAAGTAGAATTGTTGG + Intronic
1087716156 11:101611418-101611440 GTATTTAAAAGCAGAAATGTTGG + Intronic
1087829624 11:102805099-102805121 ATACTCAGTAGCGGAATTGCTGG - Intergenic
1088089069 11:106016360-106016382 GTACTAAGAAGCAGCATATTGGG - Intronic
1088302243 11:108371741-108371763 ATACCCAGAAACGGAATTGTTGG + Intronic
1088383401 11:109221534-109221556 GTAACCAGGAGCAAAATTGTTGG - Intergenic
1088415992 11:109589590-109589612 GTCTTCAGAAGCAGAATTGGTGG + Intergenic
1088451843 11:109989664-109989686 GTACTCAGAAGTGGAATTGCTGG - Intergenic
1088757396 11:112897302-112897324 ATACCCAGAAGCAGAAATGCTGG - Intergenic
1088875115 11:113929025-113929047 GTACTCAGAAGTGGAATTGCTGG + Intronic
1090125911 11:124083932-124083954 ATACCCAGAAGTAGAATTGCAGG - Intergenic
1090823557 11:130366849-130366871 GTTCTCAAAAACAGAATTGCTGG - Intergenic
1090924027 11:131234058-131234080 GTGGTCAGAAGCAGAATGGCAGG - Intergenic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091177875 11:133578241-133578263 ATACTCAGAGGTAGGATTGTTGG - Intergenic
1091574845 12:1723806-1723828 ATACCCAGAAGTAGAATTGCTGG - Intronic
1092826890 12:12408948-12408970 ATACTCAGAAGTGGAATTGCTGG + Intronic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1093314914 12:17637473-17637495 ATACCCAGAAGAAGAATTGCTGG + Intergenic
1093873949 12:24327346-24327368 GTGCACAGAAGCAGAAATGAAGG + Intergenic
1094032341 12:26026875-26026897 GTAATTAGGAGCAGAATTGCTGG - Intronic
1094062589 12:26330896-26330918 GTACACAGAAGGAGGTTTGTTGG + Intergenic
1095682102 12:44989778-44989800 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1095968503 12:47885078-47885100 GTACTCAGAACATGAATTGCTGG - Intronic
1096160415 12:49371973-49371995 TTACACAGAAGTAGAATTGCTGG + Intronic
1096314465 12:50551921-50551943 ATACCCAGAAGTAGCATTGTTGG + Intronic
1096666029 12:53165824-53165846 ATACTCAGAAGTGGAATTGCTGG - Intronic
1097328726 12:58309750-58309772 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1097593989 12:61604865-61604887 GTACTCAGAAGTAGGATTTTGGG + Intergenic
1097644825 12:62223917-62223939 ATACTCAGAAATAGAATTGCTGG - Intronic
1097819907 12:64118103-64118125 ATACCCAGAAGTAGGATTGTTGG + Intronic
1098356096 12:69614433-69614455 ATACCCAGAAGTGGAATTGTTGG - Intergenic
1098457252 12:70688668-70688690 ATACTCAGAAGTGGAATTGCTGG - Intronic
1098660777 12:73090872-73090894 ATACACAGAAGTAGAATTGCTGG - Intergenic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1099040474 12:77646895-77646917 GTACTTAGAAGTGGAATTGATGG - Intergenic
1099294281 12:80810603-80810625 CTCCCCAGAAGCAGAATTGCTGG + Intronic
1099875360 12:88398362-88398384 ATACTCAGTAGTAGAATTGCTGG - Intergenic
1099934887 12:89113167-89113189 ATACCCAGGAGCAGAACTGTTGG + Intergenic
1100022510 12:90087327-90087349 ATACCCAGAAGCGGAATTGCTGG + Intergenic
1100111648 12:91251288-91251310 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1100504198 12:95204147-95204169 GTTCTCAGAGGCAGTTTTGTTGG - Intronic
1101306574 12:103534357-103534379 GTAGTCAGCAGCACAATTGCAGG - Intergenic
1101936657 12:109063558-109063580 ACACTCAGAAGTAGAATTGCTGG + Intronic
1102655944 12:114482261-114482283 GTATTCAGAAGCAGATTTGAGGG + Intergenic
1104233872 12:126912571-126912593 GTACTCAAATACAGAAATGTTGG + Intergenic
1104239824 12:126977363-126977385 ATACTCAGAAGTAGGATTGCTGG - Intergenic
1104997263 12:132666056-132666078 GTACCCAGCAGTAGAGTTGTTGG - Intronic
1105454835 13:20530806-20530828 ATACCCTGAAGTAGAATTGTGGG - Intergenic
1105667097 13:22572236-22572258 GTACTGAGGAGTAGAATTGCTGG - Intergenic
1105823595 13:24101992-24102014 ATACCCAGAAGTAGGATTGTTGG + Intronic
1106010423 13:25815666-25815688 ATACCCAGAAGTAGAATTGCTGG - Intronic
1106148057 13:27069584-27069606 GTACCTAGAAGTAGAATTGCTGG - Intronic
1106689711 13:32101479-32101501 ATACCCAGAAGCTGAATTGCTGG + Intronic
1106733847 13:32569424-32569446 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1106799227 13:33239387-33239409 ATACTAAGAAGTAGAATTGCTGG + Intronic
1106910373 13:34456773-34456795 ATACTCAGAAGCAGAATTGCTGG - Intergenic
1106967322 13:35086669-35086691 ATACTCAGTAGCAGGATTGCTGG + Intronic
1107006464 13:35617568-35617590 GTTCTCAGAGGCAGCAGTGTGGG - Intronic
1107456719 13:40562365-40562387 GTACTCAAAAGAAAGATTGTTGG - Intronic
1108010450 13:46002397-46002419 ATACCCAGAAGTAGAATTGCTGG - Intronic
1108068085 13:46599358-46599380 ATACTCAGAAGTAGAATTGCTGG + Intronic
1108109929 13:47058734-47058756 ATACTCAGAAGTAAAATTGCTGG + Intergenic
1108638230 13:52357379-52357401 CTACTCAGAAGTAGAATTGCTGG - Intergenic
1108639379 13:52368528-52368550 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1108785463 13:53895776-53895798 GTACCCAGAAGTAGGATTGCTGG - Intergenic
1108930703 13:55814661-55814683 ATACACAGGAGCAGAATTGCTGG - Intergenic
1109084806 13:57956353-57956375 ATATTCAGAAGTAGAATTGCTGG + Intergenic
1109400085 13:61815777-61815799 ATACTCAGAAGTAGGATTCTTGG - Intergenic
1110305395 13:73981248-73981270 ATACCCAGAAGTAGAATTGCTGG - Intronic
1110489282 13:76084867-76084889 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1110590268 13:77248743-77248765 ATACCCAGAAGTGGAATTGTTGG - Intronic
1112173374 13:96995840-96995862 ATTCCCAGAAGCAGAATTGCTGG - Intergenic
1113124988 13:106967999-106968021 ATACTCAGAAGTAGAATTACTGG + Intergenic
1113419499 13:110159581-110159603 ACACCCAGAAGTAGAATTGTGGG - Intronic
1113583251 13:111444136-111444158 ACACCCAGAAGCAGAATTGTTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114420325 14:22577100-22577122 GTACCCAGAAGTGGAATTGCTGG - Intronic
1115082216 14:29468694-29468716 ATATTCAGAAGCAGAATTGCTGG + Intergenic
1115103263 14:29728788-29728810 ATACCCAGAAGCAGCATTGTTGG + Intronic
1115779366 14:36752377-36752399 ATACCCAGAAGTAGAATTGCTGG - Intronic
1115917736 14:38335675-38335697 GTTCCCAGAAGTAGGATTGTTGG + Intergenic
1116228124 14:42179597-42179619 ATACACAGAAGTAGCATTGTGGG - Intergenic
1116279019 14:42877613-42877635 ATACTCAGAAGTAGGACTGTTGG - Intergenic
1117381773 14:55171600-55171622 ATACCCAGAAGTAGAATTGCTGG - Intronic
1117622844 14:57605586-57605608 ATACTCAGTAGTAGAATTGCTGG - Intronic
1118728152 14:68645508-68645530 GTACCCAGAAGTGGAATTGCTGG + Intronic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1119295934 14:73533191-73533213 GTACCCAGAAGTAGAATTGCTGG - Intronic
1119299573 14:73560878-73560900 GTACCCAGAAGTAGAATTGCTGG - Intergenic
1120052662 14:79885431-79885453 GTAAGCAGAAGAAGAATTGCTGG - Intergenic
1120411189 14:84157942-84157964 GTGCTCAGAAGCATGACTGTGGG - Intergenic
1121588908 14:95084363-95084385 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1122295405 14:100702965-100702987 ATACTCAGCAGCGGAATTGCTGG + Intergenic
1122440040 14:101725384-101725406 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1122897287 14:104765816-104765838 GTACCCAGAAGTGGAATTGCTGG - Intronic
1122966843 14:105134711-105134733 ACACCCAGAAGCAAAATTGTGGG - Intergenic
1123950770 15:25271831-25271853 GTACTTAGGAGCAGAATTGTTGG - Intergenic
1124122656 15:26903466-26903488 ATACTCAGTAACAGAATTGCTGG + Intronic
1124418560 15:29495055-29495077 ATACCCAGAAGTAGAATTGTTGG + Intronic
1124448282 15:29759973-29759995 GTACCCAGAAGTGGAATTGCTGG + Intronic
1125170986 15:36766416-36766438 ATACCCAGAAGCAGGATTGCTGG + Intronic
1125933297 15:43615345-43615367 ATACTCAGAGGCAGTAGTGTGGG - Intronic
1125946395 15:43714807-43714829 ATACTCAGAGGCAGTAGTGTGGG - Intergenic
1126132917 15:45360622-45360644 GAACTGTGCAGCAGAATTGTTGG + Intergenic
1126222285 15:46228205-46228227 ATACTCAGAAGCAGGGTTGCTGG - Intergenic
1128280856 15:66393101-66393123 GTACTCAGAAGTGGAATTGCTGG + Intronic
1128299403 15:66556136-66556158 ATACCCAGAAGTAGAATTGCTGG - Intronic
1128627067 15:69220228-69220250 ATACTGAGAAGTGGAATTGTTGG + Intronic
1128858454 15:71042480-71042502 GTACTCAGAAGTAGAATCAGGGG - Intronic
1129012430 15:72433629-72433651 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1129129734 15:73482848-73482870 GTACTCATAAGTAGAATTGCTGG + Intronic
1129759209 15:78119435-78119457 ATACCCAGAAGTAGAATTGCTGG + Intronic
1130203820 15:81857272-81857294 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1130902448 15:88217232-88217254 TTACCCAGAAGTAGAGTTGTTGG - Intronic
1130943642 15:88533412-88533434 ATACCCAGAAGTAGAATTGTTGG - Intronic
1131159664 15:90096959-90096981 ATATACAGAAGCAGAATTGCTGG - Intronic
1131878780 15:96839824-96839846 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1132593529 16:737517-737539 GTACCAAGAAGCAGACTTGACGG - Intronic
1134088422 16:11374821-11374843 ATACCCAGAAGTAGAATTGCTGG + Intronic
1134268319 16:12710968-12710990 GGACTCAGATATAGAATTGTTGG - Intronic
1135108938 16:19675483-19675505 GTACCCAGAAGTAGCATTGCTGG + Intronic
1135273825 16:21093262-21093284 GTACTATGAAGCACAATTGCTGG - Intronic
1135556268 16:23439194-23439216 CTACTCAGAAGTGGAATTGCTGG - Intronic
1135556280 16:23439342-23439364 CTACTCAGAAGTGGAATTGCTGG - Intronic
1137517052 16:49155117-49155139 ATACTCAGAAGCAAGATTGCTGG - Intergenic
1137633441 16:49964956-49964978 TTACTCAGAGGCTGAAGTGTAGG - Intergenic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1138304592 16:55962817-55962839 GTAATGAGATGCATAATTGTAGG - Intergenic
1139183446 16:64774186-64774208 ATACTCAGAAGTAGGATTGTGGG + Intergenic
1140998713 16:80287499-80287521 GTACCTAGAAGCAGAATTGCTGG - Intergenic
1141002990 16:80325452-80325474 CAACTCAGAGGCAGAATTGCTGG + Intergenic
1141458902 16:84164776-84164798 ATACTCAGGAGCACAATTGCTGG + Intronic
1142947300 17:3441635-3441657 ATACTCAGAAGTAAAATTGCTGG - Intronic
1143287477 17:5801012-5801034 GTCCTCAGAAGCAGCAATCTGGG - Intronic
1143914635 17:10280512-10280534 ATACCCAGAAGCAGAATTGCTGG + Intergenic
1143930351 17:10416464-10416486 ATACTCAGAAGTAGAATTGTGGG + Intronic
1143973297 17:10811668-10811690 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1144279005 17:13705777-13705799 GTATTCAGGAGCAGAATTGCTGG + Intergenic
1144708089 17:17383276-17383298 GTACCCAGAAGTAGGGTTGTTGG + Intergenic
1144716362 17:17438620-17438642 ATACCCAGAAGTGGAATTGTGGG - Intergenic
1144940528 17:18936616-18936638 ATACCCAGGAGCAGAATTGCTGG - Intergenic
1145065902 17:19761151-19761173 ATAATCAGAAGCAGAATTGCTGG + Intergenic
1145094447 17:20013213-20013235 ATACCCAGAAGTAGAATTGTTGG + Intronic
1145832710 17:27929986-27930008 GTACTCTGAAGAAAAATTCTAGG - Intergenic
1147249001 17:39141647-39141669 ATACCCAGAAGCGGAATTGCTGG + Intronic
1147838716 17:43354937-43354959 ATACTTAGAATCAGTATTGTGGG + Intergenic
1148316805 17:46708203-46708225 ATACTCAGAAGTGGAATTGCTGG + Intronic
1148829642 17:50423118-50423140 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1149049355 17:52286582-52286604 GTTCTGAGAAACAGAACTGTGGG - Intergenic
1149061478 17:52427905-52427927 GTATCCAGTAGCAGAATTATCGG - Intergenic
1149776254 17:59359807-59359829 GTACTAAGAAACAGAAGGGTGGG + Intronic
1149903077 17:60499543-60499565 ATACTCAGAAGTTGAATTGCTGG - Intronic
1150017207 17:61570181-61570203 GTACTTAGGAGCGGAATTGCTGG + Intergenic
1150706638 17:67493004-67493026 ATTCTCAGGAGCTGAATTGTTGG + Intronic
1151242126 17:72766330-72766352 ATACTTAGAAGAAGAATTGCTGG + Intronic
1152485459 17:80588587-80588609 ATACCCAGAGGCAGAATTGCTGG + Intronic
1153135126 18:1908998-1909020 GAACACAAAAGCAGAAATGTGGG - Intergenic
1153141646 18:1979328-1979350 GTACCCAGAAGTAAAATTGCTGG + Intergenic
1153192929 18:2562408-2562430 ATACCCAGAAGTGGAATTGTTGG - Intronic
1153254642 18:3158420-3158442 GTTCTTAGAACTAGAATTGTTGG + Intronic
1153258363 18:3196433-3196455 CTACTCAGAAACTGAGTTGTTGG - Intronic
1153274704 18:3356760-3356782 ATACCCAGAAGAAGCATTGTTGG - Intergenic
1153326352 18:3824257-3824279 GTGTTCAGAAGCAGAGATGTGGG + Intronic
1153721793 18:7911276-7911298 ATACTTAGGAGCAGAATTGCTGG + Intronic
1154000842 18:10481184-10481206 GTACCCAGAAGGAGAATAGGTGG - Intronic
1154287046 18:13068859-13068881 GGACTCAGCAGAAGAATTCTCGG + Exonic
1155013779 18:21811348-21811370 ATATTCAAAAGCAGAACTGTTGG - Intronic
1155296576 18:24390241-24390263 ATACCCAGAAGTAGAATTGCTGG - Intronic
1155314312 18:24556364-24556386 ATAACCAGAAGCAGAATTGCTGG - Intergenic
1155361071 18:25003434-25003456 GTACCCAGAAGTAGGATTGCTGG + Intergenic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1155600892 18:27546040-27546062 ATACCCAGAAGCGGGATTGTGGG - Intergenic
1155765921 18:29632481-29632503 ATACCCAGAAGGAGAATTGCTGG + Intergenic
1155863658 18:30936487-30936509 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1156148438 18:34214643-34214665 GTACACAGAAGCAGGTTTGCTGG - Intronic
1157073856 18:44442758-44442780 GTATCCAGAAGTAGAATTGTTGG - Intergenic
1157120623 18:44907365-44907387 ATACTTAGGAGCAGAATTTTGGG + Intronic
1157265806 18:46220542-46220564 GTTAACAAAAGCAGAATTGTGGG - Intronic
1157483570 18:48071621-48071643 GTACTCAAAAGTAGAATTGCTGG - Intronic
1157588793 18:48822671-48822693 ATACTCAGAAGCGGGATTGCTGG + Intronic
1157635763 18:49152613-49152635 ATACCCAGAAGTGGAATTGTTGG - Intronic
1157681049 18:49607256-49607278 TTACTTAGGAGTAGAATTGTTGG - Intergenic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1157932384 18:51837349-51837371 GTACCCAGAAGTCGAATTGATGG + Intergenic
1158348970 18:56545318-56545340 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1159361524 18:67410800-67410822 GAATTCACAAGCAGAATTCTTGG + Intergenic
1159960584 18:74552792-74552814 GTACTCAGGAATAGAATTGCTGG + Intronic
1160166344 18:76515927-76515949 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1161834223 19:6634330-6634352 GTACATAGAAGTAGAATTGCTGG - Intergenic
1161885448 19:6991105-6991127 TTACCCAGAGGCAGAATTATTGG - Intergenic
1163001661 19:14372108-14372130 ATACTCAGGAGCAGAATGGCTGG + Intergenic
1163052860 19:14697707-14697729 ATACTGAGGAGCAGAATTGCTGG + Intronic
1164471011 19:28532529-28532551 ATACCTAGAAGTAGAATTGTTGG - Intergenic
1164728963 19:30487158-30487180 ATTCTCAGAAGCAGAATTACTGG - Intronic
1165084369 19:33333179-33333201 GTACTCAGAAGTGAAATTGCTGG - Intergenic
1165548085 19:36559260-36559282 ATAGCCAGAAGCAGAATTGCTGG - Intronic
1165984241 19:39753651-39753673 GTACCCAGTAGCAGGATTGTTGG - Intergenic
1166405332 19:42517808-42517830 ATACTCAGAAGTGGAATTGCTGG - Intronic
1167204616 19:48092385-48092407 ATACTCAGAGGTAGAATTGCTGG - Intronic
1167400155 19:49261103-49261125 GTACCCGGAAGTGGAATTGTTGG - Intergenic
1168500744 19:56890880-56890902 ATACTCAGAAGTGGAATTGCTGG + Intergenic
927335930 2:21924264-21924286 ATACTTAGATGTAGAATTGTGGG + Intergenic
927473990 2:23398088-23398110 AGGCTCAGAAGCAGAATTGCTGG - Intronic
928054532 2:28038894-28038916 GTACCCAGTAGTAGAATTGCTGG + Intronic
928156825 2:28884394-28884416 ATACTTAGAAGCAGAATTGCTGG + Intergenic
928358893 2:30647203-30647225 GTTCTTAGAAGCAGGATTGTGGG - Intergenic
929117246 2:38454985-38455007 GTACCTAGGAGCAGAATTGCTGG + Intergenic
929184353 2:39078425-39078447 GTACTTAGAAGTAGAATTGCTGG - Intronic
929619353 2:43338860-43338882 GTATTCAAAAGTGGAATTGTTGG + Intronic
929954676 2:46447172-46447194 GAAGTCAGAGGCAGCATTGTGGG + Intronic
930049306 2:47202100-47202122 ATACCCAGGAGTAGAATTGTTGG - Intergenic
930275937 2:49311190-49311212 GTACTCAGTAGTAGGATTGCTGG + Intergenic
930551906 2:52846481-52846503 ATACTTAGGAGCAAAATTGTTGG + Intergenic
931153536 2:59601817-59601839 ATACACAGAAGAAGAATTGCTGG + Intergenic
931329074 2:61261138-61261160 ATACCCAGAAGTGGAATTGTTGG - Intronic
931594215 2:63923400-63923422 ATACCCAGAAGTAGAATTGCTGG - Intronic
931923892 2:67050139-67050161 GTACTCAGAAGGGTAATTGTTGG - Intergenic
932725537 2:74176910-74176932 ATACTTAGGAGCAGAATTGCTGG - Intronic
933827371 2:86174966-86174988 GTTTTCAGAAGAGGAATTGTTGG + Intronic
935323551 2:101912392-101912414 GTACCCAGAAGTGGAATTGCTGG - Intergenic
935629911 2:105205276-105205298 ATACTCGGAAGTAGAATTGTTGG + Intergenic
935874896 2:107495870-107495892 CTACTCAGAAGCATAATTACTGG + Intergenic
935974881 2:108568539-108568561 TTACTCAGAAGTAGGATTGCTGG + Intronic
936602016 2:113906008-113906030 ATACCCAGAAGTGGAATTGTTGG + Intronic
937005474 2:118508715-118508737 GTACTTAGGAGTAGAATTGCTGG - Intergenic
937252122 2:120531125-120531147 ATACCCAGAAGTAGAATTGCTGG - Intergenic
938826940 2:135015056-135015078 GTATTTAGGAGCAGAATTGCTGG + Intronic
938841366 2:135167913-135167935 GTAATCAGAATTAAAATTGTAGG + Intronic
938844335 2:135193499-135193521 GTACTCAAAAGTGGAATTGCTGG - Intronic
939263671 2:139843346-139843368 GTACTCAGCAGTAGAATTACTGG - Intergenic
939712697 2:145542625-145542647 GTACCCAGGAGTAGAATTGGTGG + Intergenic
939926533 2:148181371-148181393 ATACCCAGGAGCAGAATTGCTGG + Intronic
939986203 2:148831935-148831957 GTAACCAGAGGCAGAATTCTGGG + Intergenic
940359334 2:152780734-152780756 GTACTCAGAAGTGGGATTGCTGG + Intergenic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
940762862 2:157756785-157756807 GTACTCAGTAGTGGAATTGCTGG - Intronic
940879221 2:158929728-158929750 GAACTCAGAAGCAGCTTAGTTGG + Intergenic
941103651 2:161326533-161326555 ATACCCAGAAGCTGAATTGCTGG - Intronic
941678005 2:168364978-168365000 ATACTCAGACGTTGAATTGTTGG - Intergenic
941716091 2:168764857-168764879 ATACCCAGAAGTGGAATTGTTGG - Intronic
941807786 2:169726179-169726201 GTACCCAGCAGCAGGATTGCTGG - Intronic
942057941 2:172202639-172202661 ATACTCAGCAGCAGGATTGCTGG - Intergenic
942589100 2:177521885-177521907 GTACTCATAAGGAGAAATATTGG - Intronic
942650347 2:178160551-178160573 ATACCCAGAAGTAGAATTGGTGG + Intergenic
944935905 2:204567723-204567745 ATACCCAGAAGTAGAATTGCTGG + Intronic
945255985 2:207803678-207803700 ATACTCAGAAGTGGAATTGCTGG + Intergenic
945479384 2:210326552-210326574 ATACTCAGAAGTAGGATTGCTGG + Intergenic
945792681 2:214325125-214325147 GTTCTCAAAAGCTGGATTGTGGG - Intronic
946938013 2:224742021-224742043 ATACCCAGAAGTAGAATTGCTGG + Intergenic
947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG + Intergenic
947587132 2:231363331-231363353 ATACCCAGAAGAAGAATTGGTGG + Intronic
948503743 2:238413591-238413613 ATGCTCAGAAGTAGAATTGCTGG + Intergenic
948504532 2:238419409-238419431 ATACTCAGAAGTGGAATTGCTGG + Intergenic
948546395 2:238732471-238732493 GTACTTAGGAGCACAATTGCTGG + Intergenic
1169334587 20:4745486-4745508 TTACTGAGAAGTAGAATTGGTGG - Intergenic
1169939055 20:10917258-10917280 ATATTCAGAAGTAGAATTATTGG - Intergenic
1170079784 20:12461459-12461481 ATACTCAGAAGTAGTATTGCTGG - Intergenic
1170209339 20:13832566-13832588 ATACTAAGCAGCAGAATTGCTGG + Intergenic
1170216585 20:13898113-13898135 ATACCCAGAAGTAGAATTGCTGG - Intronic
1170406999 20:16048789-16048811 ATACTCGGGAACAGAATTGTGGG - Intronic
1170443362 20:16400489-16400511 GTACCCAGAAGTAGAATTGCTGG - Intronic
1171049933 20:21848158-21848180 GTACTCAGAATTGGAATTGCTGG - Intergenic
1171378326 20:24711166-24711188 GTACTTAGAAGTGGAATTGCTGG + Intergenic
1172172462 20:32947118-32947140 GTATTTAGAAGCAGAATGGCTGG + Intronic
1172790327 20:37500320-37500342 ATACTTAGAAACAGAATTGATGG - Intronic
1173079843 20:39855209-39855231 ATACTCAGAAGTGGAATTGTTGG + Intergenic
1173378803 20:42516646-42516668 GTACTTAGAAGTAGAATTAATGG + Intronic
1173425508 20:42939790-42939812 GGACTCAGAAGTAAAAATGTAGG + Intronic
1174671849 20:52315560-52315582 GTGCCCAGAAGCAGACATGTAGG + Intergenic
1174995732 20:55566404-55566426 GTACTCAGAAGGGAAATTGCTGG + Intergenic
1175514840 20:59562601-59562623 GTACCCAGAGGCAGAACTGCCGG - Intergenic
1176133607 20:63508479-63508501 ATGCTCAGAAGCGGAATTGCTGG + Intergenic
1177113793 21:17061154-17061176 CCACTTAGAAGCAGAATTGAAGG + Intergenic
1177703962 21:24676060-24676082 GTAGTCAGGGGCAGAAGTGTGGG + Intergenic
1177858079 21:26421652-26421674 ATACTCAGAAATTGAATTGTTGG - Intergenic
1177964048 21:27705060-27705082 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1178039733 21:28626867-28626889 ATACTTAGGAGCAGAATTGTTGG - Intergenic
1178095523 21:29211230-29211252 ATACTCAGAAGCATAATTACTGG - Intronic
1178627400 21:34229415-34229437 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1179066899 21:38033427-38033449 ATACTCAGAAGTGGAATTGCTGG + Intronic
1179119949 21:38534700-38534722 ATACCCAGAAGTAGAATTGCTGG - Intronic
1179834505 21:44020993-44021015 TTTCTCAGAAGCATAATTTTAGG - Intronic
1180652900 22:17393528-17393550 GTACTAAGAAGTGGAATTGGTGG + Intronic
1180677638 22:17598803-17598825 ATACCCAGAAGTAGAATTGCTGG - Intronic
1181411134 22:22720629-22720651 GGGCTCAGAAGCAGAGTTCTGGG + Intergenic
1181583429 22:23840193-23840215 GTACCCACAAGCAGCATTGCTGG - Intergenic
1182175675 22:28284974-28284996 ATACTCAGACGTAGAATTGCTGG - Intronic
1182385964 22:29941417-29941439 ATACCCAGGAGTAGAATTGTTGG + Intronic
1182674445 22:32027206-32027228 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1183141840 22:35949396-35949418 ATATTCAGAAGCAGAACTGCTGG + Intronic
1183757620 22:39784377-39784399 ATACTCAGTAGTAGAATTGCTGG - Intronic
949347930 3:3094618-3094640 GTAATCAGCAGTGGAATTGTTGG + Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
950208655 3:11100134-11100156 ATACCTAGGAGCAGAATTGTTGG + Intergenic
950223693 3:11216251-11216273 ATACTGAGAAACGGAATTGTTGG - Intronic
950375930 3:12572473-12572495 GTACTAAGTGACAGAATTGTTGG + Intronic
950622672 3:14218480-14218502 GTACTTAGGAGCAGAATGGCTGG + Intergenic
950905395 3:16533270-16533292 ATACTCAGAAGTGGAATTGCTGG + Intergenic
951069876 3:18314968-18314990 ATACCCAGAAGTAGAATTGCTGG + Intronic
951350699 3:21603372-21603394 GTTACCAGAAGCAGAATTGCTGG - Intronic
951748701 3:26009200-26009222 GTACTTAGAAGTGGAATTGATGG + Intergenic
951869138 3:27340827-27340849 ATACCCAGTAGCAGAATTGCTGG - Intronic
952109507 3:30106417-30106439 GTACTCAGCAGTAGCATTGCTGG + Intergenic
952177607 3:30882674-30882696 ATACTCAGAAGTAGAATTGCTGG + Intronic
952183529 3:30944115-30944137 GTCCTCAGAAACAAAACTGTTGG - Intergenic
952461570 3:33532001-33532023 ATACCCAGAAGTAGAATTGCTGG - Intronic
952778382 3:37069220-37069242 GTACCCAGAAGTGGAATTGCTGG - Intronic
952826246 3:37527428-37527450 AGACTGAGAAGCAGAATTTTAGG - Intronic
953139812 3:40218117-40218139 ATACTTAGGAGTAGAATTGTTGG - Intronic
953318691 3:41952697-41952719 ATACTCAGAAGTGGAATTGCTGG - Intronic
953724418 3:45385257-45385279 CTACTCAGAAGTAGAGTTGCTGG + Intergenic
953935787 3:47040981-47041003 GTACTTAGAAGTGGAATTGTTGG - Intronic
954288097 3:49633558-49633580 ATACCCAGAAGTGGAATTGTTGG - Intronic
954528303 3:51294070-51294092 ATACCCAGAAGTGGAATTGTTGG - Intronic
954817790 3:53296894-53296916 ATACCCAGGAGCAGAATTGCTGG + Intronic
954889868 3:53915737-53915759 ATACTCAGAAGCAAAATTGCTGG + Intergenic
955171981 3:56575052-56575074 GTACTCAGAATTGGAATTGCAGG + Intronic
955500769 3:59580351-59580373 ACACACAGAAGCAGACTTGTTGG - Intergenic
955928300 3:64029659-64029681 GTTCCCAGAAGCAGGATTGCTGG - Intergenic
956616128 3:71174590-71174612 GTATTCAGAAACAGTCTTGTGGG - Intronic
957184409 3:76923245-76923267 GTGTTCAGAAGCAGAATGGCGGG - Intronic
957378106 3:79386769-79386791 GAAGCCAGAAGCAGGATTGTGGG + Intronic
957404312 3:79757172-79757194 GTACCCAGAAGTAGAATTGCTGG + Intronic
958537051 3:95417676-95417698 GTAATCAGATGTAGAATTGCTGG - Intergenic
959654680 3:108789187-108789209 GTACCCAGAAGAAGAATTGCTGG - Intergenic
959723525 3:109518520-109518542 ATACTGAGAAGTTGAATTGTTGG + Intergenic
959726449 3:109547871-109547893 ATACCCAGAAGTAGAATTATTGG + Intergenic
959823071 3:110759479-110759501 ATACTCAGTAGTAGGATTGTTGG + Intergenic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
961005167 3:123400403-123400425 ATTCTCAGAAGCAGAATTAGTGG - Intronic
961350454 3:126297959-126297981 GTACCCAGTAGCAGGATTGCTGG + Intergenic
961804931 3:129482512-129482534 GTTCTCAGCAGCAGAATCGATGG + Intronic
962289040 3:134115145-134115167 GTACCCAGAAGTAGGATTCTTGG - Intronic
962843711 3:139257359-139257381 ATACGCAGAAGTAGAATTGCTGG + Intronic
963291087 3:143490150-143490172 ATACCCAGAAGTAGAATTGCTGG - Intronic
963350005 3:144140176-144140198 GTCCTCAAAAGCAGCATTGTTGG - Intergenic
963955642 3:151250778-151250800 GTGCCCAGAAGCAAAATTGCTGG + Intronic
964800256 3:160548800-160548822 ATACTCAGAAGTGGAATTGCTGG + Intronic
965047979 3:163603762-163603784 ATACTCAGCAGTGGAATTGTTGG - Intergenic
965104644 3:164341191-164341213 GGACTCAGATGCTGAATTTTAGG + Intergenic
965951857 3:174318564-174318586 GTAATCAGAAGCAGTATTCAGGG - Intergenic
966235520 3:177697528-177697550 ATACTCAGAAATAGAATTGCTGG - Intergenic
966518874 3:180850870-180850892 ATACTCAGTAGCAGTACTGTTGG + Intronic
966698015 3:182813227-182813249 ATACCCAGAAGTAGAATTGCTGG + Intronic
966963388 3:184964946-184964968 ATACCCAGAAGTAGAATTGTTGG + Intronic
967165453 3:186775785-186775807 ATACTCAGAAGTGGAATTGGTGG + Intergenic
967622111 3:191646244-191646266 ATACTCAGTAACGGAATTGTTGG - Intergenic
968400190 4:287801-287823 GTGCTCAGAAGTAGAATTACTGG + Intronic
968461859 4:730189-730211 GTGCACAGCAGCAGAATTGCGGG + Intronic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
971346113 4:25813175-25813197 GTATCCAGAAGCAGAATTTCTGG - Intronic
971544769 4:27871212-27871234 ATACACAGAAGTAGAATTGCTGG - Intergenic
972143637 4:35994022-35994044 GTACTTAAAAGTAGAATTATTGG - Intronic
972283558 4:37626518-37626540 GTACTGAGAAGTGGGATTGTTGG - Intronic
972373812 4:38451415-38451437 ATACTCAGAAGTAGAATTGCTGG - Intergenic
974677897 4:65118955-65118977 ATACTCAGAAGTGGAATTGTTGG + Intergenic
975761715 4:77626704-77626726 ATACCCAGAAGTGGAATTGTTGG + Intergenic
975894373 4:79069687-79069709 TTACCCAGAAGTGGAATTGTTGG - Intergenic
975981408 4:80164114-80164136 GTACCCAGAAGTGGAATTGCTGG - Intergenic
976240609 4:82952585-82952607 GTACCCAAAAGTAGAATTGCTGG - Intronic
976443051 4:85098743-85098765 ATGCTCAGAAGTATAATTGTTGG + Intergenic
976768375 4:88622495-88622517 GTACCTAGAAGTGGAATTGTTGG + Intronic
976784234 4:88799783-88799805 ATACTCAGCAGTGGAATTGTTGG - Intronic
977013674 4:91664703-91664725 GTAATTAGAAGTGGAATTGTTGG + Intergenic
977033563 4:91919711-91919733 ATACCCAGTAGCAGAATTGCTGG + Intergenic
977139149 4:93345166-93345188 ATACTCAGAAGTAGGATTGCTGG + Intronic
977367256 4:96085999-96086021 GTGCCCAGAAGTACAATTGTTGG - Intergenic
977501034 4:97837227-97837249 GATCTTAGAAGCAGAATTCTAGG + Intronic
979217072 4:118178693-118178715 ATACCCAGAAGCAGAATTGCTGG + Intronic
979342819 4:119547803-119547825 TTTCTGAAAAGCAGAATTGTTGG - Intronic
979822015 4:125186908-125186930 GTACCCAGAAGTGGGATTGTTGG + Intergenic
980282725 4:130741394-130741416 ATACTTAGAAGTAGAATTGCTGG + Intergenic
980387758 4:132108624-132108646 AAACTCAAAAGCAGAATGGTGGG + Intergenic
981551906 4:145950477-145950499 ATACTCTGAAGTAGAATTGCTGG - Intergenic
981858898 4:149330521-149330543 ATACTCAGAAGTGGAATTGGTGG + Intergenic
981868670 4:149459930-149459952 ATACTCAGAAGTGGAATTGCTGG + Intergenic
983397700 4:167221937-167221959 ATACTCAGAAGTGGAATTGCTGG - Intronic
984722938 4:182993149-182993171 ATACTCAGAAGCGTAATAGTTGG - Intergenic
984724466 4:183007418-183007440 GCACTCAGAAGAGAAATTGTTGG - Intergenic
984730204 4:183060983-183061005 ATACCCAGAAGTGGAATTGTTGG + Intergenic
984934246 4:184876271-184876293 ATACTCAGAAGTAGGATTGCTGG - Intergenic
985084794 4:186301395-186301417 GTACCCAGGAGCAGAATTTCTGG + Intergenic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
986210859 5:5670663-5670685 ATACTCAGTAACAGAATTGCTGG + Intergenic
986387987 5:7256310-7256332 GTACTGAGAGGCAGGATTGGTGG - Intergenic
986652865 5:9981767-9981789 ATACTTAGAAGTGGAATTGTGGG - Intergenic
986789701 5:11147834-11147856 ATACCTAGAAGCAGAATTGATGG - Intronic
987264854 5:16242714-16242736 GTACACAGAAGTAGAATTGCTGG - Intergenic
987429399 5:17813943-17813965 ATACCCAGAAGTAGAATTGCTGG + Intergenic
989674609 5:43958950-43958972 AAATTCAGAAGCAGATTTGTTGG + Intergenic
990000927 5:50891807-50891829 ATACACAGAAGCAGGATTGCTGG - Intergenic
990113029 5:52351405-52351427 ATACTCAGAAACAGAATTGCTGG + Intergenic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
990438921 5:55824224-55824246 ATACTCAGAAGTGGAATTGCTGG + Intergenic
990767562 5:59203467-59203489 ATACCCAGAAGTAGAATTGCTGG - Intronic
990902479 5:60767523-60767545 ATACCCAGAAGCAGAATTGCTGG + Intronic
992800341 5:80289879-80289901 ATACTCAGAAGTGGAATTGTTGG - Intergenic
992949351 5:81842057-81842079 GTACCCAGAAGTGGAATTGCTGG + Intergenic
993304491 5:86258093-86258115 ATACTCAGAAGTGGTATTGTTGG - Intergenic
993447739 5:88035104-88035126 GTACCCAGAAGTAGGATTGCTGG + Intergenic
993942806 5:94081320-94081342 ATACCCAGAAGTAGAATTGCTGG - Intronic
994237161 5:97376247-97376269 GTACTCAGAAGTAGAAAGGTAGG - Intergenic
994577693 5:101600745-101600767 GTACTCAGTAGTAGGATTGCTGG - Intergenic
994669081 5:102744790-102744812 GTACAAAGGAACAGAATTGTTGG - Intergenic
995121460 5:108540396-108540418 ATACTCAGAAGTAGAATTACTGG - Intergenic
995382958 5:111555366-111555388 ATACCCAGAAGTAGAATTGCTGG + Intergenic
996268079 5:121567523-121567545 ATATTCAGAATCAGAATTGTTGG - Intergenic
996313825 5:122138588-122138610 GTACTAATAAGGACAATTGTTGG - Intronic
996851966 5:127963202-127963224 GTACTTAGAAAAAGAATTTTGGG + Intergenic
996899370 5:128526379-128526401 ATACCCAGAAGTGGAATTGTTGG - Intronic
997914565 5:137911482-137911504 ATACCCAGAAGTAGAATTGCTGG + Intronic
998949904 5:147382937-147382959 GTGATCAGAAGCAGCAGTGTCGG + Intronic
999555327 5:152735813-152735835 GTACCCAGAAGCTGGATTGCTGG + Intergenic
999634904 5:153611604-153611626 GTTCACAGATGCATAATTGTTGG + Intronic
999918659 5:156292612-156292634 ATACCCAGAAGTAGAATTGCTGG + Intronic
1000034977 5:157439515-157439537 GTACCCAGAAGTGGAATTGCTGG - Intronic
1000405289 5:160881421-160881443 ATACCAAGAAGCACAATTGTTGG - Intergenic
1000624715 5:163526086-163526108 ATACCCAGAAGTGGAATTGTTGG + Intergenic
1001308298 5:170591957-170591979 GTATCCAGAAGCAGAATTCTTGG + Intronic
1002362334 5:178682302-178682324 ATACCCAGAAGTAGGATTGTTGG - Intergenic
1003043838 6:2714589-2714611 ATACTCAGAAGTGGAATTGCTGG - Intronic
1003091792 6:3110139-3110161 ATACTCAGAAACGGAATTGCTGG + Intronic
1003215837 6:4110354-4110376 ATACCCAGAAGTGGAATTGTGGG + Intronic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1003516637 6:6823935-6823957 GTTCACAGAATCAGAAATGTGGG + Intergenic
1003915765 6:10785184-10785206 GTACACAGAAACAGGACTGTGGG - Intronic
1004015162 6:11725661-11725683 GTACCCAGAAGTGGAATTGCTGG - Intronic
1004020551 6:11772229-11772251 GAACTCAGAAGCAGCATTTCAGG - Intronic
1004469230 6:15914150-15914172 ATACCCAGAAGCAGAATGGCTGG - Intergenic
1005290325 6:24373219-24373241 GTACAAAGTAGAAGAATTGTTGG - Intergenic
1005349839 6:24923380-24923402 ATACCCAGAAGTGGAATTGTTGG + Intronic
1005877527 6:30023690-30023712 GTACCCAGAAGAGGAATTGCTGG + Intergenic
1006383231 6:33713268-33713290 ATACCCAGAAGCGGAATTGCTGG + Intergenic
1006405253 6:33841360-33841382 GGCCTGAGAAGCTGAATTGTGGG - Intergenic
1006747363 6:36352828-36352850 ATACTTAGAAGCAGGATTGCTGG + Intergenic
1007867540 6:44989515-44989537 ATACCCAGAAGCAGCATTGCTGG + Intronic
1008151924 6:47963464-47963486 GTACTCAGAAGTGGGATTGCTGG - Intronic
1008589718 6:52981921-52981943 ATTCTCAGAAGGAGAATGGTAGG + Intronic
1008785949 6:55168261-55168283 GTACTGAAAAGTAGAATTATAGG - Intronic
1008977339 6:57443260-57443282 GTACCCAGAAGTAGGATTGCTGG + Intronic
1009165474 6:60336213-60336235 GTACCCAGAAGTAGGATTGCTGG + Intergenic
1009196287 6:60689816-60689838 ATACTCAAAAGCAGAATTGCTGG + Intergenic
1009344712 6:62599144-62599166 ATACCCAGAAGCAGAATTGCTGG + Intergenic
1009620933 6:66076223-66076245 ATACCCAGTAGCAGAATTGCTGG + Intergenic
1010475985 6:76287990-76288012 ATACCCAGAAATAGAATTGTTGG + Intergenic
1011210566 6:84951744-84951766 TTACTCAGAAATAGAATTGCTGG - Intergenic
1011259228 6:85454208-85454230 CTACCCAGGAGCAGAATTGCTGG + Intronic
1011571651 6:88743803-88743825 ATTTTCAGAAGCAGAATTGCTGG + Intronic
1011776143 6:90732847-90732869 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1011796378 6:90958062-90958084 GTTCTCAGAATTAGAATTGCTGG + Intergenic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1012793206 6:103726760-103726782 ATACTCAGCAGCAGGATTGCTGG + Intergenic
1013047374 6:106500179-106500201 GTACCCAGAAGCAGGATTGCTGG + Intergenic
1013151426 6:107450052-107450074 ACACCCAGAAGCAGAATTGTTGG + Intronic
1013197075 6:107853768-107853790 ATACTCAGAAGTAGAGTTGCTGG + Intergenic
1013252970 6:108353107-108353129 ATACTCAGAAGTGGAATTGCTGG + Intronic
1013614422 6:111828388-111828410 ATACCCAGAAGTAGAATTGCTGG - Intronic
1013985100 6:116182396-116182418 ATACTCAGGAGCAGGATTGCTGG + Intronic
1014001245 6:116368993-116369015 TCACTCAAAAGCAAAATTGTGGG + Intronic
1014456304 6:121638476-121638498 GTGCTTGGAAGCAGAAATGTTGG + Intergenic
1014511468 6:122327718-122327740 GTACTGAGGAGTAGAATTGGTGG - Intergenic
1014697288 6:124639199-124639221 ATACCCAGTAGAAGAATTGTTGG - Intronic
1014898665 6:126935339-126935361 TTACACAGAAGTGGAATTGTTGG + Intergenic
1015096789 6:129424835-129424857 ATACACAGAAGCAGAATGGCTGG - Intronic
1015148306 6:130012232-130012254 ATACTCAGAAGTAGTATTGCTGG - Intergenic
1015464958 6:133538734-133538756 GTACCCAGAAGTGGAATTGCTGG + Intergenic
1015887690 6:137935533-137935555 GTACTCAGAAGTGGGATTGCTGG + Intergenic
1016707850 6:147134097-147134119 ATACTCAGAAGTAGGATTGCTGG - Intergenic
1017117485 6:150992220-150992242 ATACCCAGAAGTAGCATTGTTGG - Intronic
1017585169 6:155912650-155912672 GTATTCAGGAGCAAAATTGCTGG + Intergenic
1018939752 6:168301322-168301344 TTCCTCAGAAGCAGAGGTGTAGG - Intronic
1019761492 7:2816003-2816025 GTACTTAGACGCAGAGTTGCTGG - Intronic
1019899501 7:4008908-4008930 ATACTGAGAAGCAGAATTGCTGG + Intronic
1020483025 7:8685618-8685640 GTACCCAGCAGTAGGATTGTTGG + Intronic
1021497142 7:21288468-21288490 ATACTCAGAAGAGGAATTGCTGG - Intergenic
1021608929 7:22437614-22437636 GTACACAGAAGTAGAATTGCTGG + Intronic
1021777261 7:24065983-24066005 ATACTCAGTAGCAGGATTGCTGG - Intergenic
1022691667 7:32662271-32662293 ATACTAGGAGGCAGAATTGTAGG - Intergenic
1022829442 7:34050529-34050551 GTTCTCAGAATTAGAGTTGTTGG - Intronic
1022896503 7:34755135-34755157 GTAACTAGAAGCAGAATTGCTGG + Intronic
1022897499 7:34766332-34766354 ATACTCAGAAGTGGAATTGTTGG - Intronic
1022916756 7:34963457-34963479 GTACCCAGAAGTGGAATTGCTGG - Intronic
1023071261 7:36436483-36436505 ATACATAGGAGCAGAATTGTGGG + Intronic
1023197192 7:37654119-37654141 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1023544340 7:41301833-41301855 TTACTCAGTAGCAGGATTGCTGG + Intergenic
1023712032 7:43005283-43005305 GTACTCAGAAGTAGAATTGCTGG + Intergenic
1023930707 7:44704068-44704090 GTACTCAGAAGTGGAATTGCTGG + Intronic
1024020918 7:45368115-45368137 ATACCCAGAAGTGGAATTGTTGG + Intergenic
1024087351 7:45905832-45905854 TCACCCAGGAGCAGAATTGTTGG - Intergenic
1024369287 7:48561254-48561276 ATACCCAGAATCAGAATTGCTGG + Intronic
1024668494 7:51568554-51568576 GTACCCAGAAGTGGAATTATTGG - Intergenic
1024680119 7:51677675-51677697 GTACTCAGAAGAATGATTGCTGG - Intergenic
1025195627 7:56930312-56930334 GTACCTAGAAGTAGAATTGCTGG + Intergenic
1025676323 7:63646627-63646649 GTACCTAGAAGTAGAATTGCTGG - Intergenic
1026130028 7:67612522-67612544 GTATTTAGGAGCGGAATTGTTGG - Intergenic
1026260546 7:68751522-68751544 GTACCCAGTAGAGGAATTGTTGG + Intergenic
1028358550 7:89938985-89939007 AAACTCAGAAGTAGAATTGCTGG + Intergenic
1028415578 7:90576940-90576962 GTACCCAGAAGTGGAATTGCTGG - Intronic
1028612769 7:92730893-92730915 ATACTCAGAAGTGGAATTGCTGG + Intronic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1028937213 7:96479468-96479490 GTACACAGAGGGAGAAATGTGGG - Intergenic
1029013327 7:97286290-97286312 ATACCTAGAAGTAGAATTGTTGG + Intergenic
1029513556 7:101011899-101011921 ATACCCAGAAGTAGAATTGCTGG + Intronic
1030261378 7:107568195-107568217 GTACCCAGATGTAGAATTGCTGG + Intronic
1030511088 7:110482681-110482703 GTACTTAGAAGTAGAATTGCTGG - Intergenic
1030785552 7:113656740-113656762 ATACCCAGAAGCAGATTTGCAGG - Intergenic
1031243575 7:119277144-119277166 ATACTCAGCAGCAGGATTGCTGG + Intergenic
1031251916 7:119394610-119394632 ATACCCAGAAGCAGGATTGCTGG - Intergenic
1031263105 7:119548293-119548315 ATACTCAGAGGTAGAATTGCTGG - Intergenic
1031956826 7:127951047-127951069 ATACCCAGAAGCAGAATTGCTGG - Intronic
1032221315 7:129996508-129996530 ATACACAAAAGCAGAATTGCTGG + Intergenic
1032543439 7:132723249-132723271 ATACCCAGAAGTAGAATTGCAGG - Intronic
1032579666 7:133092461-133092483 GTACCCAGGAGTAGAATTGCTGG - Intergenic
1032624813 7:133580354-133580376 CTACTCAGAAGTGGAATTGTTGG + Intronic
1033170828 7:139082477-139082499 ATAATCAGAAGTAGAATTGCTGG - Intronic
1033381428 7:140823670-140823692 ATACACAGAAGGAGAATTGATGG + Intronic
1034031774 7:147774601-147774623 GTCCTCATAAGCAGAAATGCCGG + Intronic
1035419895 7:158718471-158718493 ATACTAAGGAGCACAATTGTTGG - Intergenic
1035540207 8:429051-429073 ATACCCAGAAGTGGAATTGTTGG + Intronic
1036099789 8:5767046-5767068 ATACCCAGTAGTAGAATTGTTGG + Intergenic
1036187052 8:6631817-6631839 ATACCCAGAAGAGGAATTGTTGG - Intronic
1036535248 8:9643751-9643773 ATACCCAGAAGCAGAATTGCCGG - Intronic
1036825191 8:11970439-11970461 GTCCTCAGAAGCAGATGAGTGGG + Intergenic
1036989121 8:13571718-13571740 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1037037897 8:14190556-14190578 GTACACAGAAGAGGGATTGTTGG + Intronic
1037178887 8:15979785-15979807 GTACTCAGTAGTGGAATTGTTGG + Intergenic
1037293531 8:17376447-17376469 ATACTTAGGAGCAGAATTGCTGG + Intronic
1037523058 8:19698800-19698822 ATACTTAGAAGCAAAATTGCTGG - Intronic
1037780665 8:21866597-21866619 GTACATAGGAGCTGAATTGTGGG - Intergenic
1038555438 8:28509943-28509965 GTAGTCAGAAGTGGAATTGCTGG + Intronic
1038982693 8:32776848-32776870 GAACTCAGAAGAAGACATGTGGG + Intergenic
1038989291 8:32848398-32848420 GTACCCAGAAGTGGGATTGTTGG + Intergenic
1039581844 8:38673244-38673266 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1039643470 8:39251183-39251205 TTACTCAGTAGTAGAATTGCTGG + Intronic
1040419647 8:47226856-47226878 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1040885385 8:52257293-52257315 CTACTTAGAAGAAGAATTGCTGG + Intronic
1041084973 8:54248300-54248322 ATACCCAGAGGCAGGATTGTGGG - Intergenic
1041495619 8:58482448-58482470 ATACTCAGAAGTAGGATTGCTGG + Intergenic
1041810838 8:61908175-61908197 TTACCCAGAAGTAGAATTGCTGG + Intergenic
1042189456 8:66170778-66170800 ATACTCAGAAGTGGAATTGCAGG - Intronic
1042352383 8:67790401-67790423 GTACCCAGCAGAAGAATTGCTGG - Intergenic
1042670359 8:71256189-71256211 ATAATCAGAAGGGGAATTGTGGG - Intronic
1042832341 8:73045036-73045058 GTACCCAGAAGTGGAATTGCTGG + Intronic
1043200133 8:77358253-77358275 GTACTCAACAGCAGAATGGAGGG - Intergenic
1043438010 8:80253115-80253137 GCACTCACCAGCAGAGTTGTGGG + Intergenic
1043569340 8:81584656-81584678 GTACTCAGAAATGGAATTGCTGG + Intergenic
1043696673 8:83228084-83228106 ATACTCAAGAGCAGAATTGCTGG + Intergenic
1044022427 8:87122077-87122099 ATACTCAGAAGTAGAATTACTGG + Intronic
1044394178 8:91690161-91690183 ATACCCAGAAGAAGGATTGTTGG - Intergenic
1044471710 8:92577476-92577498 ATACCCAGGAGCAGAATTGCTGG + Intergenic
1044816923 8:96122997-96123019 ATACTCAGAAGCAGAATTGCTGG + Intergenic
1045122605 8:99054186-99054208 ATACTGAGAAGTAGAATTGCTGG + Intronic
1046418281 8:113943912-113943934 GTACACAGAAGCTGTATTTTAGG - Intergenic
1046785481 8:118261291-118261313 GAATTCAGGAGAAGAATTGTTGG - Intronic
1046931775 8:119848595-119848617 GTACCTAGGAGCAGAATTGATGG - Intronic
1047438175 8:124852911-124852933 GTAATTAGAAGTGGAATTGTTGG - Intergenic
1047550300 8:125864470-125864492 ATACTCAGAAGAGGAATTATGGG + Intergenic
1047560251 8:125979607-125979629 ATACTCAGTAGTAGAATTGCTGG - Intergenic
1047947591 8:129897601-129897623 CTACTCAGAAGCTAAATTCTTGG - Intronic
1048203489 8:132396633-132396655 GTACGCAGAGGCAGAAATCTTGG - Intronic
1050219806 9:3374305-3374327 ATACTGAGAAGCGGAATTGCTGG - Intronic
1050568271 9:6910414-6910436 GCACTGAGAGGCACAATTGTGGG + Intronic
1050833427 9:10044179-10044201 ATACTCAGAAACACAATTATAGG - Intronic
1050898929 9:10920290-10920312 GTACCCAGAAGTAGGGTTGTTGG - Intergenic
1051368893 9:16341548-16341570 GTCCCTAGAAGCAGAATTGCTGG + Intergenic
1051441309 9:17086227-17086249 GTTTTCAGAATCCGAATTGTAGG + Intergenic
1051508833 9:17855085-17855107 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1051774206 9:20617002-20617024 GCACTTAAAAGCTGAATTGTTGG - Intronic
1051832156 9:21291709-21291731 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1052530502 9:29677831-29677853 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1052594280 9:30538279-30538301 ATACACAGTAGCAGAATTGCGGG + Intergenic
1052715685 9:32114198-32114220 GTAGCCAGAAGCAGAATTTCTGG - Intergenic
1053078223 9:35153084-35153106 GTTTTCAGAAGAAGAATAGTTGG + Intergenic
1053119295 9:35533970-35533992 ATACCTAGAAGCAGAATTGCTGG + Intronic
1053728922 9:41032778-41032800 GTATTCAGAAGCAGAATTATTGG - Intergenic
1054699590 9:68399305-68399327 GTATTCAGAAGCAGAATTATTGG + Intronic
1055006333 9:71511569-71511591 GTACTCAGTAGTGGAATTGCTGG - Intergenic
1055211582 9:73801343-73801365 ATACCCAGAAGCAGAATTGCTGG - Intergenic
1055531341 9:77187241-77187263 ATACCCAGAAGCAGAATTACTGG + Intronic
1055536585 9:77252990-77253012 ATACTCAGAAGTAGAATTGCTGG + Intronic
1055855737 9:80685606-80685628 ATACCCAGAAGTTGAATTGTTGG - Intergenic
1056145715 9:83727015-83727037 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1056177892 9:84053018-84053040 TTCCTCAGAAGCAGTATTATTGG - Intergenic
1056183099 9:84104771-84104793 GTAATAAGAAACAGAATTGAGGG + Intergenic
1057246266 9:93457253-93457275 ATACTCAGAAGTAGGATTGCTGG + Intronic
1057707874 9:97410572-97410594 ATACCCAGGAGCAGAATTGCTGG + Intergenic
1058165474 9:101614241-101614263 GGACTCAGGAACAGAATTGCTGG - Intronic
1058195936 9:101975904-101975926 ATACCCAGAAGTTGAATTGTTGG + Intergenic
1058339601 9:103878229-103878251 GGACTAAGAATCAGAATTATTGG - Intergenic
1058456690 9:105144331-105144353 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1058880503 9:109281878-109281900 TTACCTAGAAGTAGAATTGTTGG - Intronic
1059036547 9:110760191-110760213 ATACTCAGTAGCGGAATTGCTGG - Intronic
1059085498 9:111297776-111297798 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1059373835 9:113866033-113866055 ATACTCAGAAGTTGAGTTGTGGG - Intergenic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1060473684 9:123969571-123969593 GTACTCAAAAGTGGAATTGCTGG + Intergenic
1060699052 9:125734822-125734844 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1061336080 9:129937223-129937245 ATTTTCAGAAGCAGAATTTTTGG - Intronic
1061640029 9:131946259-131946281 ATACCCAGTAGCAGAATTGCTGG + Intronic
1061658611 9:132112389-132112411 GAACTCAGATGCAGATTTCTAGG - Intergenic
1062159613 9:135073084-135073106 GTACTCAGAAGTGGAATTGCTGG + Intergenic
1185749012 X:2595449-2595471 GTGCCCAGAAGCAGAATTGCTGG - Intergenic
1186254788 X:7706992-7707014 GCACTCAGAAGCAGCTTTCTGGG - Intergenic
1186458992 X:9733456-9733478 GTACTGTGTAACAGAATTGTGGG + Intronic
1188712196 X:33414825-33414847 ATACCCAGAAGTAAAATTGTTGG - Intergenic
1188812860 X:34673246-34673268 GTACTCAGGAGTGGAATTATGGG + Intergenic
1188875087 X:35419630-35419652 ATACGCAGAAGTAGAATTGTCGG + Intergenic
1188990178 X:36809289-36809311 GTACCCAGAAGTAGAATTGCTGG + Intergenic
1189073783 X:37894306-37894328 ATACTCAGGAGTAGAATTGTTGG + Intronic
1189095030 X:38129459-38129481 ATACTCAGAAGTGGAATGGTTGG - Intronic
1189425169 X:40893577-40893599 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1189579944 X:42395744-42395766 ATACTCAGAAGAAGGTTTGTAGG + Intergenic
1189686436 X:43568679-43568701 GGACTCAGAAGTGGGATTGTTGG - Intergenic
1189831351 X:44976839-44976861 GTACTGAGAAATGGAATTGTTGG + Intronic
1189887023 X:45557668-45557690 ATACCTAGGAGCAGAATTGTGGG + Intergenic
1190720094 X:53140544-53140566 GTACCCAGGAACAGAATTGTTGG - Intergenic
1190994184 X:55589223-55589245 ATACTCAGAAGTAGCATTGCTGG - Intergenic
1191989837 X:67022646-67022668 GTACCCAGAAGTAGAATTGCTGG + Intergenic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1192906211 X:75553947-75553969 GTACCCAGAAGAGGAATTGCTGG + Intergenic
1193428946 X:81376497-81376519 ATATTCAGAAGCAGAACTTTTGG - Intergenic
1193669723 X:84369427-84369449 ATACCCAGAAGTGGAATTGTTGG + Intronic
1194329626 X:92565264-92565286 GTACCCAGCAGTAGAATTGCTGG - Intronic
1194336190 X:92649551-92649573 ATACTCAGTAGCGGAATTGCTGG - Intergenic
1194373854 X:93109172-93109194 GTCCTCACAAGGAGAAATGTTGG - Intergenic
1194517204 X:94869720-94869742 GTACCCAGAAGTGGAATTGCTGG - Intergenic
1194931484 X:99893086-99893108 GTACTCAGAAGTAGGATTGTTGG - Intergenic
1195259622 X:103119190-103119212 GTACCCAGTAGCAGGATTGCTGG + Intergenic
1195263575 X:103158211-103158233 GTGCTCAGAGTCAGAATTGCAGG + Intergenic
1195500914 X:105597937-105597959 ATACCCAGAAGAGGAATTGTTGG - Intronic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1195895467 X:109741875-109741897 ATACTTAGGAGTAGAATTGTTGG - Intergenic
1195922505 X:109997723-109997745 GTACTCAGAAGCAAAATGAGAGG - Intergenic
1195935482 X:110121697-110121719 GTACCTAGAAGTAGAATTGCTGG + Intronic
1195979519 X:110562130-110562152 ATACTCAAGAGCAGCATTGTTGG + Intergenic
1196121151 X:112052134-112052156 ATACTCAGAAGCAAAACTGCTGG + Intronic
1196727152 X:118906054-118906076 ATACCCAGAAGCAGGATTGCTGG + Intergenic
1196913342 X:120506588-120506610 ATACCCAGCAGCAGAATTGCTGG + Intergenic
1196943417 X:120799928-120799950 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1197021904 X:121700692-121700714 GTACTCAGAAGTGGTATTGTTGG + Intergenic
1197197796 X:123720541-123720563 GTACTCAGAAGTAGGAATGCTGG - Intronic
1197411117 X:126117589-126117611 GTACTCAGAAGAGGGATGGTTGG + Intergenic
1198294193 X:135269727-135269749 ATACTCAGCAGTGGAATTGTTGG - Intronic
1198796552 X:140402726-140402748 GTACCCAGAAGTGGGATTGTTGG - Intergenic
1198931034 X:141860428-141860450 ATACTCAGAAGTAGAATTACTGG - Intronic
1199337435 X:146635971-146635993 ATACCCAGGAGTAGAATTGTTGG - Intergenic
1199346914 X:146751888-146751910 GTACTCAGAAGTGAAATTGCTGG - Intergenic
1199506855 X:148572388-148572410 ATACTTAGAAGCGTAATTGTTGG - Intronic
1199568347 X:149241895-149241917 ATACTCAGAAGAAGGATTGATGG - Intergenic
1199795168 X:151188424-151188446 ATACTCAGAAGTAGAATTGCTGG + Intergenic
1200307681 X:155044839-155044861 ATACTCAGAAGAGGAATTGCTGG - Intronic
1200313766 X:155108441-155108463 GTACACAGAAGTGGAATTGCTGG + Intronic
1200325276 X:155231307-155231329 GAACACAGAAGTAGAAATGTGGG - Intronic
1200638327 Y:5684456-5684478 GTACCCAGCAGTAGAATTGCTGG - Intronic
1200644622 Y:5766298-5766320 ATACTCAGTAGCGGAATTGCTGG - Intergenic
1200681883 Y:6223234-6223256 GTCCTCACAAGGAGAAATGTTGG - Intergenic
1201271185 Y:12255651-12255673 AAACTCAGAAGTAGAATAGTGGG + Intergenic
1201348587 Y:13013216-13013238 GTACCCAGAAGTAGAATTACTGG + Intergenic
1201917704 Y:19199963-19199985 GTACCCAGAAGTGGAATTGCTGG - Intergenic