ID: 968839035

View in Genome Browser
Species Human (GRCh38)
Location 4:2987643-2987665
Sequence CAGAAGCAGAATTGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968839032_968839035 18 Left 968839032 4:2987602-2987624 CCTGTTTGAGTCCGTGCTTTCAC 0: 1
1: 0
2: 13
3: 64
4: 167
Right 968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG 0: 1
1: 0
2: 4
3: 18
4: 299
968839033_968839035 7 Left 968839033 4:2987613-2987635 CCGTGCTTTCACTTGTTTTGTGT 0: 1
1: 0
2: 67
3: 407
4: 1475
Right 968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG 0: 1
1: 0
2: 4
3: 18
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968839035 Original CRISPR CAGAAGCAGAATTGTTGGCC AGG Intronic
901532147 1:9860293-9860315 CAGAACCAGGATTCTAGGCCGGG + Intronic
902873285 1:19326777-19326799 CAGAAGCAGAAATGGAGGCTCGG - Intronic
905500727 1:38434205-38434227 CAGAGGGAGAATTCTTGGGCTGG - Intergenic
905687284 1:39917662-39917684 GAAAATAAGAATTGTTGGCCGGG - Intergenic
907540131 1:55208330-55208352 CAGAAACAATAATGTTGGCCAGG + Intronic
907725930 1:57020521-57020543 CAGCAGGAGAATGGGTGGCCTGG - Intronic
908115042 1:60932460-60932482 CGGAAGCAGAATTGTTAGTGGGG - Intronic
908211915 1:61909273-61909295 CAGAAGAAAAATTGTAGGTCAGG - Intronic
908374105 1:63516125-63516147 CAGAAGCAGAAAATTAGGCCAGG + Intronic
908427535 1:64022205-64022227 CAGAAGTTGAATTGGTTGCCAGG + Intronic
911688031 1:100799692-100799714 CAATAGCAGAATTGTTTTCCAGG - Intergenic
912403252 1:109414122-109414144 CACAAGCAGTTTTGTAGGCCTGG - Intronic
912546017 1:110452481-110452503 CAGGAGCAGCGTGGTTGGCCTGG + Intronic
913267611 1:117060296-117060318 CGGAAGCAGAATTGGGGGCGGGG + Exonic
913500714 1:119470318-119470340 CAGAAGCAGAATTGTAGTGTAGG - Intergenic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
914259327 1:145985654-145985676 GGGAAGCACAAATGTTGGCCAGG + Intergenic
917102606 1:171461114-171461136 CAAAAGAAAAATTGTGGGCCAGG + Intergenic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
919745390 1:201005450-201005472 CAGAAGCAGAAGTGAGGGCTTGG + Intronic
919883876 1:201918647-201918669 CAAAAGAAGAAGTGTTAGCCAGG - Intronic
921026207 1:211284907-211284929 CAGAAGCAGAATAGAGAGCCAGG - Intronic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
922022547 1:221719032-221719054 CAGATGCAGCATTTTTGGCTGGG - Intronic
922033391 1:221825593-221825615 CAGAGGCAGAAAAGTGGGCCTGG + Intergenic
922480771 1:225939164-225939186 CAGAAATTGTATTGTTGGCCAGG - Intronic
922879921 1:228972967-228972989 CAAGAGCAGAACTGATGGCCTGG + Intergenic
924628702 1:245716785-245716807 CAGAAGAAGAAATGCTGGCTGGG + Intergenic
924745746 1:246832234-246832256 TAGAAGTAGAAATGCTGGCCGGG + Intergenic
1063168478 10:3484948-3484970 GAGATGCAGACATGTTGGCCAGG - Intergenic
1064065993 10:12181945-12181967 TAGAGGCAGTGTTGTTGGCCAGG - Intronic
1067910537 10:50342321-50342343 CTGAAATAGAATTGTTGGTCTGG - Intronic
1068771153 10:60822999-60823021 CTGAAGCACAATGGTTGTCCAGG - Intergenic
1070516952 10:77217001-77217023 CAAAAACTGAATTTTTGGCCAGG + Intronic
1070610469 10:77928729-77928751 TAGAAGCATATTTTTTGGCCAGG + Intergenic
1070897336 10:79996063-79996085 CAGAAGCAGAACTGCTGGGCTGG + Intergenic
1071021426 10:81061403-81061425 CAGAACCACAAGTTTTGGCCAGG + Intergenic
1072303435 10:94084447-94084469 CAGAAGAGGAATAGGTGGCCGGG - Intronic
1073398921 10:103241104-103241126 CCGAAGCAGAAATTTTGGTCAGG + Intergenic
1073607914 10:104914681-104914703 CTGAAGCTGAGCTGTTGGCCAGG + Intronic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1076290184 10:129340080-129340102 CTGCAGCGGGATTGTTGGCCTGG + Intergenic
1077527116 11:3073703-3073725 AAGAAGAAGGATCGTTGGCCAGG - Intergenic
1078216027 11:9312608-9312630 CATAAGAATAATTGTAGGCCAGG + Intronic
1079517108 11:21281930-21281952 CACAAGAAGAATTTTTGCCCAGG - Intronic
1081684573 11:45033157-45033179 CAGCAGCAGAATTGTTGACCAGG + Intergenic
1085431160 11:76450083-76450105 CAGAAAGAGAATTGTGTGCCAGG - Intronic
1087544285 11:99564381-99564403 TATAAACAGAATTGTTGGCCAGG - Intronic
1088165957 11:106937550-106937572 CAGAAGCACAATATTTGGCTAGG - Intronic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1089245788 11:117118698-117118720 CAAAAGTATAATTGATGGCCAGG + Intergenic
1091432816 12:451277-451299 CAGAAGCAGAATCAGTGACCAGG - Intergenic
1091807112 12:3364799-3364821 CAGGTGCAGAATTGGTGGTCTGG - Intergenic
1092964866 12:13631772-13631794 CAAGAACAGAATTATTGGCCAGG + Intronic
1093058450 12:14578489-14578511 TAGAGACAGAGTTGTTGGCCAGG - Intergenic
1093226939 12:16496123-16496145 TAGGAGCAGAATTGCTGGGCTGG - Intronic
1096304782 12:50464686-50464708 CAAAAAAAGAATTGTTGGTCAGG - Intronic
1096711098 12:53456772-53456794 CAGAGGCTGAACTGTTGTCCTGG + Intronic
1096925083 12:55135377-55135399 CAGAAGCAGGACTGGTGGGCTGG - Intergenic
1097649384 12:62277641-62277663 CAGAAGAAGAATTATTGTCTTGG + Intronic
1097821344 12:64131879-64131901 CAAAAGGAGAGTAGTTGGCCAGG + Intronic
1097864511 12:64548483-64548505 AAGAAGTAAAATTGTTGGCCAGG - Intergenic
1098190737 12:67945725-67945747 AAGAAGCTGGATTTTTGGCCGGG - Intergenic
1098940391 12:76528025-76528047 TATAAGCATTATTGTTGGCCAGG + Intronic
1099403422 12:82228604-82228626 AGGAAAAAGAATTGTTGGCCGGG + Intronic
1103043922 12:117719489-117719511 CAAGACCTGAATTGTTGGCCAGG - Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103557090 12:121773298-121773320 CAGAAGCAGAAAGGGTGCCCTGG - Intronic
1104457238 12:128924989-128925011 AAGAAGCAGCATTGTTTCCCAGG - Intronic
1105635243 13:22210234-22210256 CAGAAGCAGAGTTGAAAGCCAGG + Intergenic
1105721759 13:23123661-23123683 TAGAAACAGAAGTGTAGGCCAGG - Intergenic
1107112348 13:36711666-36711688 TAAAAGAAGAATTGTAGGCCAGG - Intergenic
1108269925 13:48749389-48749411 CAGAACTAGAATTGTAGCCCAGG - Intergenic
1109104975 13:58239411-58239433 CAGAAGCAGGACAGCTGGCCTGG - Intergenic
1110452741 13:75655164-75655186 CAGAAGATGTATTATTGGCCAGG - Intronic
1111851027 13:93574996-93575018 GAAAAGGTGAATTGTTGGCCAGG + Intronic
1112187998 13:97146474-97146496 CAGAAGGAGTGCTGTTGGCCAGG + Intergenic
1112973862 13:105292927-105292949 CAAAAGCAGAATTATTAGGCTGG - Intergenic
1113375812 13:109764889-109764911 CAGAAGTAGAATTGTTTTTCTGG + Intronic
1113494702 13:110717529-110717551 TACAAGTAGTATTGTTGGCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115579494 14:34743960-34743982 CAAAAACAAAACTGTTGGCCGGG - Intergenic
1116794583 14:49376047-49376069 CAAAAGTAAAATAGTTGGCCGGG + Intergenic
1116913674 14:50499360-50499382 TAGAAGCAGTATTGGGGGCCAGG + Intronic
1118297765 14:64585878-64585900 CAGAATCAGAATTGTTAGGAGGG + Intronic
1119360489 14:74045027-74045049 CAGAAACAGAAAGGTTGGCCGGG - Intronic
1119632376 14:76244227-76244249 AAGAACCAGAGTTCTTGGCCAGG + Intronic
1119990740 14:79194440-79194462 CAGAAGCAGAATTGCTCTTCTGG - Intronic
1121392123 14:93584503-93584525 CAGAAACACAACTGTAGGCCTGG - Intronic
1121433905 14:93906331-93906353 AGGATGCAGAATAGTTGGCCAGG - Intergenic
1121795039 14:96727745-96727767 CAAGAGCAGCATGGTTGGCCAGG + Intergenic
1123173310 14:106394728-106394750 CAAAAGCAGAATTGAAGGACTGG + Intergenic
1125933878 15:43618213-43618235 AGGAAGAAGAAATGTTGGCCAGG + Exonic
1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG + Intergenic
1128858538 15:71043618-71043640 GAGATGCAGAATAGTTGGCTTGG + Intronic
1129323844 15:74789305-74789327 CAGCAGCAGAATTGGGCGCCAGG - Intronic
1129487270 15:75886410-75886432 CTAAAGCACAATAGTTGGCCAGG - Intronic
1130533378 15:84765094-84765116 AAGAAGTAGAATTGGTTGCCAGG - Intronic
1130543722 15:84840071-84840093 CAGAAGCAAAACTGTTGATCAGG - Exonic
1133664225 16:7950074-7950096 TAGGAATAGAATTGTTGGCCGGG + Intergenic
1133793182 16:9025333-9025355 CAAAAAAAGAATTATTGGCCGGG - Intergenic
1134222454 16:12365745-12365767 CAAAAGCAGAACAGTGGGCCGGG + Intronic
1134869997 16:17643840-17643862 CAGAAGCTGAATGTTAGGCCTGG + Intergenic
1135554095 16:23421043-23421065 CAGAAACAGCATTTTGGGCCAGG - Intronic
1136360203 16:29774499-29774521 CAGAAGCAGAGATGGGGGCCTGG + Intergenic
1136394424 16:29985400-29985422 CAGAGGCAGAAAAGCTGGCCCGG + Exonic
1138316488 16:56074287-56074309 AAGAAGCAGAGTTATTGGCTGGG - Intergenic
1138500915 16:57443640-57443662 TAGCAACAGAGTTGTTGGCCAGG + Intronic
1139652061 16:68367362-68367384 CAGAAGTTGAGTTGTGGGCCGGG + Intronic
1140171229 16:72607231-72607253 CAAAAACTGAATTTTTGGCCAGG + Intergenic
1140747651 16:77995291-77995313 CTGAAGCAGCATTGTTGTCTGGG + Intergenic
1140863037 16:79035888-79035910 AAGAAGCTGAATTCTTGGCTGGG - Intronic
1141090049 16:81123912-81123934 CAGCAGCAGCTCTGTTGGCCTGG - Intergenic
1141455758 16:84140806-84140828 CAGTAACAGTATTGCTGGCCGGG + Intronic
1141532740 16:84658032-84658054 CAGAAGCAGGATAGTTGTCAAGG - Intronic
1141866729 16:86755471-86755493 CAGAGGCAGAAATGTGGACCAGG - Intergenic
1141873457 16:86805620-86805642 TAGAAGCAGAATTATTAGACTGG + Intergenic
1141920671 16:87133540-87133562 CAGAAGCAAAGTGCTTGGCCTGG + Intronic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1147651058 17:42062316-42062338 GAGAAGCAGAAATCCTGGCCAGG + Intronic
1147927935 17:43956665-43956687 GACAAGGAGAATTGTTGGCTGGG - Intronic
1149417667 17:56477285-56477307 CTTCAGCAGAATTCTTGGCCAGG - Intronic
1150011363 17:61507428-61507450 CAGAGAAATAATTGTTGGCCTGG - Intergenic
1150039615 17:61845734-61845756 CAGAAGCAGGATGGATGTCCTGG - Intronic
1150494702 17:65598295-65598317 CACAAGCATAAATCTTGGCCGGG + Intronic
1151224722 17:72639990-72640012 GAGAAGCACAATTGTGGGCTGGG + Intergenic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151426149 17:74032354-74032376 CAGAAGCAGAGCTGCTGGCCAGG + Intergenic
1151524297 17:74653403-74653425 CAGTAACAGAATTTTTGGCTGGG - Intergenic
1151897814 17:76992043-76992065 CAGAAGCAGCTCTGATGGCCAGG - Intergenic
1153622471 18:6991683-6991705 AAGAAGTAGAATTATTGGCTGGG - Intronic
1153643749 18:7176469-7176491 CAGAACGAGAAATGTGGGCCGGG - Intergenic
1154012346 18:10586420-10586442 CAGAAGCAGAATTGTAAGATGGG - Intergenic
1154488730 18:14902388-14902410 CTGAGGGTGAATTGTTGGCCCGG + Intergenic
1156065836 18:33141428-33141450 CAGAAGCAGAAGAGCTGGCTGGG + Intronic
1156764324 18:40632911-40632933 CATTAGCAGAATTGTTGGCTTGG + Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158465431 18:57685950-57685972 CAAAAACACAATTGTAGGCCGGG + Intronic
1158554686 18:58465636-58465658 CAGAAGCAGAGCTGTTGACAAGG - Intergenic
1158935588 18:62361572-62361594 CAGAATCAAAAATGTTGGTCTGG - Intronic
1160139859 18:76311785-76311807 CAGAAGTCGAATTGTTGGTTGGG + Intergenic
1160236907 18:77093133-77093155 CAGAAGCTGGATTGTGTGCCTGG + Intronic
1161385957 19:3993051-3993073 CAGAATAAGAAATGTTGGCCAGG - Intergenic
1163534324 19:17868534-17868556 CAGAAGGGGAATTGATGTCCAGG + Intergenic
1164597100 19:29537492-29537514 CAGAAACAGGATTGCTGGCAGGG - Intronic
1166378310 19:42341134-42341156 TAAAAACAGAATTTTTGGCCAGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1167813891 19:51861424-51861446 CACAAGAAGAATCATTGGCCAGG - Intronic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
926863832 2:17337835-17337857 CAGTAGCAGAATTATTGAGCAGG - Intergenic
927479711 2:23442594-23442616 CTGAAGTAGAAGTGTTGGCAGGG - Intronic
927970397 2:27302350-27302372 CTGAGGCAGAATTGTTTACCTGG + Intronic
928774882 2:34748954-34748976 CAGAAGGATAATTGGAGGCCAGG - Intergenic
929527138 2:42715181-42715203 AAGTGGCAGCATTGTTGGCCTGG + Intronic
929693875 2:44097974-44097996 CACAAGCAGAATTATAGGGCTGG + Intergenic
929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG + Intronic
929915797 2:46134436-46134458 CAGAAGCAGGGTTGTTAGCATGG - Intronic
930799232 2:55425242-55425264 CAGAAGCAGCATATTTGGCTGGG - Intergenic
931419878 2:62117029-62117051 CAGCAGCAGAACTGTAGGCAAGG - Intronic
932858153 2:75260510-75260532 CAGAAGCTGAATTCCAGGCCAGG - Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
936081091 2:109432821-109432843 CAGAAGGTGAAATGTGGGCCTGG - Intronic
936118456 2:109721476-109721498 CAGAATCAGAATTGCTGTGCTGG + Intergenic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
937962678 2:127473098-127473120 CAGATACAGAATTCTTGGCTGGG - Intronic
938096631 2:128468187-128468209 CACTAGCAGCATTTTTGGCCTGG + Intergenic
946381263 2:219350622-219350644 TGGAGGCAGAATTGGTGGCCGGG - Intergenic
947576384 2:231278317-231278339 CAGAAGCACAATTTTAGGTCAGG - Intronic
947587136 2:231363336-231363358 CAGAAGAAGAATTGGTGGATGGG + Intronic
947842823 2:233219324-233219346 CAGAAGGAGATGTGTAGGCCTGG + Intronic
948230608 2:236346463-236346485 CAGAAGCAGGACTGGAGGCCAGG + Intronic
948925773 2:241096232-241096254 CAGAAGCTGAGTTTTTGGCCAGG - Exonic
949005501 2:241644573-241644595 AGGAATCAGAAGTGTTGGCCGGG + Intronic
1170518574 20:17158970-17158992 CAGAAGCAACATTGTTGGTTTGG + Intergenic
1172106201 20:32518633-32518655 CAGACACAGAATTGCTTGCCTGG - Intronic
1172969328 20:38861968-38861990 CAAAAGAAGAACTGTAGGCCAGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1175574658 20:60051997-60052019 CAAAAGCAGAGTTCTTGACCAGG + Intergenic
1175688424 20:61048018-61048040 GAGATGCAGAATTACTGGCCGGG - Intergenic
1175846682 20:62063471-62063493 CAAAAGCAGCAATGCTGGCCAGG + Intronic
1177137697 21:17323933-17323955 AAGAATCAGTATTGTTGGCTGGG + Intergenic
1177348259 21:19900757-19900779 CAGAAGCAAGATTGCTGGGCTGG - Intergenic
1177634133 21:23765168-23765190 CAGAAGCAGATTTGGTGCTCAGG - Intergenic
1180038785 21:45265170-45265192 CAGAAGCAGGAGTGTTTGTCAGG - Exonic
1180390049 22:12221733-12221755 CAAAAGAAGAAATATTGGCCTGG - Intergenic
1180415887 22:12712736-12712758 CAAAAGAAGAAATATTGGCCTGG + Intergenic
1181544777 22:23595917-23595939 GAGAAGCATCATTGCTGGCCAGG + Intergenic
1181815530 22:25433942-25433964 GAGAAGCATCATTGCTGGCCAGG - Intergenic
1182822382 22:33228383-33228405 AAGAAGCAGAATAGTTGTGCTGG - Intronic
1183152109 22:36045975-36045997 CAGAAGAAGAATTGCTCGGCCGG - Intergenic
1183734190 22:39634871-39634893 CACAAGCAGAAGTGATGCCCAGG + Intronic
1183998256 22:41652659-41652681 CAGAAAGTGAATTATTGGCCAGG - Intronic
951229860 3:20165754-20165776 CCTAAACAAAATTGTTGGCCAGG + Intronic
953944419 3:47134064-47134086 CAGAAACAGAAATATTGGCAGGG + Intronic
954465467 3:50652036-50652058 CAGAATCAGGGCTGTTGGCCAGG - Intergenic
955663736 3:61328408-61328430 CAGAAGCAGAAGAGTAGGCAAGG - Intergenic
957682645 3:83457468-83457490 GAGAAGCAGAACTGTGGCCCTGG - Intergenic
961055314 3:123783199-123783221 CAAAAGCAGAATTCTTGGCAAGG + Intronic
961762343 3:129180942-129180964 GACAAGTAGAATTGTTGGCAAGG + Intronic
964139992 3:153386733-153386755 AAAAAGCAAAAATGTTGGCCAGG - Intergenic
964335477 3:155649681-155649703 AAGAAGTAGAATTAATGGCCGGG + Intronic
964692056 3:159461057-159461079 CTGAGTCAGAAGTGTTGGCCTGG - Intronic
965131776 3:164709795-164709817 CATAAGCAGCATTATTGGCTTGG + Intergenic
965986761 3:174763291-174763313 CAGATACAAAAATGTTGGCCGGG + Intronic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
967837311 3:193975328-193975350 CAGAGGCAAAATTGTTCCCCAGG - Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
971125620 4:23750863-23750885 CAGAACAAGAATGGTTGCCCAGG + Intergenic
971824090 4:31598569-31598591 CTGAAGAAGAATGGTTTGCCTGG + Intergenic
972296426 4:37743577-37743599 CAGGAGCAGATTTGATGGCATGG + Intergenic
972321379 4:37976547-37976569 GAGAAGCAGAATTCTTGGGCTGG + Intronic
972683276 4:41327583-41327605 CTGAAGCAGTATTGTTTGTCTGG + Intergenic
974040390 4:56852383-56852405 CTGAAGCAGAGAGGTTGGCCTGG - Intergenic
974157686 4:58095293-58095315 CAGAAGCTGAACAGATGGCCAGG - Intergenic
975594152 4:76031760-76031782 CAGAAACTGTACTGTTGGCCTGG + Intronic
975859256 4:78658675-78658697 TAGAAGTAGATTTGTGGGCCAGG - Intergenic
977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG + Intronic
978365975 4:107981958-107981980 CTGAACCAGAATTGTTTTCCTGG - Intergenic
979352463 4:119660721-119660743 CAGAAGTATAAATGCTGGCCGGG - Intergenic
980880244 4:138702694-138702716 CAGAAACAGACTGTTTGGCCAGG + Intergenic
982355264 4:154459938-154459960 CAGGTGTAGAATTGGTGGCCTGG - Intronic
984556069 4:181215349-181215371 CAGAAGCACGAATGTTTGCCAGG - Intergenic
984738795 4:183138820-183138842 CTTAAGCAGGATTGTTGGTCTGG + Intronic
985015875 4:185635430-185635452 CAGAAGCAGAAGTGTAGGGATGG + Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
986654713 5:9999735-9999757 CAGAAGTAGGACTGTTGGGCTGG - Intergenic
988492183 5:31714236-31714258 CTGAAGCAGAACTGTGGGTCAGG + Intronic
990759569 5:59113234-59113256 CAGAAGTAGAATTGATGGTAGGG + Intronic
991709062 5:69389394-69389416 CAGAGGCAGAATTTTTATCCAGG - Intronic
991777859 5:70102984-70103006 CAAAAGCTTCATTGTTGGCCAGG - Intergenic
991857147 5:70978442-70978464 CAAAAGCTTCATTGTTGGCCAGG - Intronic
994728068 5:103459865-103459887 CAGAAGCAGAATAATTGACTTGG + Intergenic
995267062 5:110174396-110174418 GAGAAGCAGATTTGTGGTCCAGG + Intergenic
996206224 5:120740180-120740202 CATAAGCAGAAATGGTGCCCTGG + Intergenic
996969456 5:129346062-129346084 CAGAAACAGAATTGAGGGGCTGG + Intergenic
998066286 5:139161719-139161741 AAGAATTAGAATTGCTGGCCAGG + Intronic
998093995 5:139387073-139387095 CAGCTGCAGAATTGCTTGCCTGG + Intergenic
998384408 5:141748153-141748175 CAGAGGAAGAATTAATGGCCTGG + Intergenic
999385600 5:151151927-151151949 CAGGAGCAGAATGAATGGCCTGG + Intronic
1000003176 5:157159494-157159516 CAGCAGCAGAATTGTTACCATGG + Intronic
1000552148 5:162680235-162680257 CAGAAGAAGTTTTGCTGGCCAGG - Intergenic
1001921459 5:175603401-175603423 TAGAATAAGAATTCTTGGCCAGG + Intergenic
1002451351 5:179320611-179320633 CAGAAGGAGAAGGGTGGGCCAGG - Intronic
1002830530 6:816394-816416 CAGAAGAAGAAATGTTTGCTGGG + Intergenic
1005752347 6:28895074-28895096 CAGAAGAAATATTGCTGGCCGGG - Intergenic
1006024156 6:31136853-31136875 CAAAAACATAAGTGTTGGCCGGG + Intronic
1007287866 6:40761167-40761189 CAAAAGCAGAAGTGTTAGTCTGG + Intergenic
1007962562 6:45973641-45973663 CAATAGCAGAATAGGTGGCCGGG + Intronic
1008960437 6:57260734-57260756 CAGGAGAAGAAATTTTGGCCAGG + Intergenic
1010234718 6:73565832-73565854 TATAAGAAGCATTGTTGGCCAGG + Intergenic
1015069914 6:129079531-129079553 CAGAAAAAGAAGTGTTGGCAAGG - Intronic
1015301502 6:131657866-131657888 CAGAAGTAAAATTTTAGGCCAGG + Intronic
1015561110 6:134517125-134517147 TAGAATCCGAGTTGTTGGCCAGG + Intergenic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1016944087 6:149512011-149512033 AAGAAGCAGAATGGTTGCACTGG - Intronic
1017096953 6:150813008-150813030 CAGAAGAACACTTGCTGGCCGGG + Intronic
1017748569 6:157469057-157469079 CAAAGGCAAAATTGTTGGCTAGG + Intronic
1017805027 6:157938001-157938023 CAGCATCAGAGTTGTAGGCCTGG + Intronic
1022740390 7:33114438-33114460 CAGAAAGAGAAATGTTGACCAGG - Intergenic
1023113243 7:36835303-36835325 CAGAGGCAGAATTATTGACTAGG + Intergenic
1023440892 7:40183876-40183898 GAAAAGCATCATTGTTGGCCGGG + Intronic
1024623324 7:51182576-51182598 CAGAAGCAGAATTTTGTGGCCGG - Intronic
1026328585 7:69332710-69332732 CAAAAAAAGAAGTGTTGGCCTGG + Intergenic
1026336302 7:69396917-69396939 CTGAATCAGAACTTTTGGCCTGG - Intergenic
1027223521 7:76229627-76229649 CAGAAGCAGAATATTTGGGAAGG - Intronic
1029849248 7:103445696-103445718 CAGAGGCAGAACTGAGGGCCTGG + Intronic
1031302440 7:120079412-120079434 CAGAAGCAGAACTGTCATCCAGG - Intergenic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1032465744 7:132143613-132143635 CAGAAGCAGATTGGTAGGCTGGG + Intronic
1033209244 7:139448289-139448311 AAAAAGGAGAAATGTTGGCCAGG - Intergenic
1037032388 8:14125184-14125206 AAGAATCACTATTGTTGGCCAGG + Intronic
1037448330 8:18990513-18990535 CAGGAGAAGGATTGCTGGCCAGG - Intronic
1037871210 8:22498827-22498849 TAAAAGTAGAATTATTGGCCGGG + Intronic
1040460119 8:47639650-47639672 CAGAAGGAGATTTATTGGCCAGG + Intronic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1041836179 8:62218667-62218689 CAGACCCAGATTTCTTGGCCTGG - Intergenic
1042436252 8:68768533-68768555 GAGAACCAGAATTGTTGGTATGG - Intronic
1043842609 8:85126259-85126281 CAGTAACATAATTTTTGGCCCGG + Intronic
1046653752 8:116870905-116870927 CAGCAGCTGAAGTGCTGGCCAGG - Intronic
1047742481 8:127817994-127818016 CAGAGGCAGAACTGATGCCCAGG + Intergenic
1047993080 8:130306964-130306986 CAGAATGAGAAGAGTTGGCCAGG - Intronic
1048169148 8:132088732-132088754 CAGAAGCAGAATTCTAAACCAGG - Intronic
1050228835 9:3494280-3494302 GATAAGCAGAGTTGTTGACCTGG + Intronic
1051048720 9:12906244-12906266 CAGAAGTAGGATTTTTGCCCAGG - Intergenic
1051860520 9:21620259-21620281 CAGAAGGAGAAATGTGGGTCAGG + Intergenic
1053159025 9:35800733-35800755 GAGAAGCAGATTTGGTGGACGGG + Exonic
1053211332 9:36230954-36230976 TAGAAACAGAATTTTTAGCCAGG + Intronic
1053298365 9:36931142-36931164 CAGAATGGGAATGGTTGGCCTGG - Intronic
1053580678 9:39400969-39400991 AAGAATCAATATTGTTGGCCAGG + Intergenic
1053845174 9:42229017-42229039 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054102265 9:60959774-60959796 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054584094 9:66947088-66947110 AAGAATCAATATTGTTGGCCAGG - Intergenic
1056000620 9:82212583-82212605 CATAATAAGAAATGTTGGCCAGG + Intergenic
1057144891 9:92751550-92751572 CAGTAACAGAATTGTTAACCTGG - Intronic
1057598974 9:96440636-96440658 CAGAATTAAAACTGTTGGCCAGG - Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1059508681 9:114823557-114823579 CAGAATGGGAATTGGTGGCCTGG + Intergenic
1060002413 9:119970378-119970400 CAAAAACAGAATCATTGGCCAGG - Intergenic
1060268782 9:122127173-122127195 CAGAAGCAGAATTGCAAGCCGGG - Intergenic
1060938386 9:127528934-127528956 CAGAAGCAGGCTTGTGGCCCAGG + Intronic
1061248267 9:129412721-129412743 CAGAAAAACAAATGTTGGCCGGG - Intergenic
1062420130 9:136476721-136476743 CAGGATCAGAGTTATTGGCCAGG + Exonic
1186507026 X:10101596-10101618 CAGGAGCAGAGCAGTTGGCCTGG - Intronic
1186607270 X:11105431-11105453 CAGAAGCAGAAATGGGGGCGGGG - Intergenic
1187291917 X:17962796-17962818 CAGAATCAGAATTGCTGGGTTGG - Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189832863 X:44992516-44992538 AAAAAGCAGTATTGCTGGCCAGG - Intronic
1192401203 X:70838121-70838143 TAGAAACACATTTGTTGGCCAGG + Intronic
1193790448 X:85809636-85809658 CAGAATCTGGATTGTTGGCTAGG - Intergenic
1194344509 X:92746703-92746725 TAGAAAAAAAATTGTTGGCCAGG - Intergenic
1194392522 X:93337958-93337980 TAGAAGTATAATTGCTGGCCGGG + Intergenic
1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG + Intronic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1197530352 X:127616626-127616648 GAGAAGCAGAACTGGTGGGCAGG - Intergenic
1197905437 X:131419960-131419982 CAGAAGCATCATTGGTGGCTTGG + Intergenic
1199262390 X:145790416-145790438 TATAAGAAGAATTCTTGGCCGGG - Intergenic
1199937736 X:152592333-152592355 CAGAAGCAGAATTGCTGGGGTGG + Intergenic
1200652853 Y:5863343-5863365 TAGAAAAAAAATTGTTGGCCAGG - Intergenic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic