ID: 968846100

View in Genome Browser
Species Human (GRCh38)
Location 4:3042298-3042320
Sequence ACTTGGGGTCTTTATTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968846089_968846100 21 Left 968846089 4:3042254-3042276 CCTTCTTTGTACGAGGGGAAGGG No data
Right 968846100 4:3042298-3042320 ACTTGGGGTCTTTATTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968846100 Original CRISPR ACTTGGGGTCTTTATTCTTT GGG Intergenic
No off target data available for this crispr