ID: 968846120

View in Genome Browser
Species Human (GRCh38)
Location 4:3042439-3042461
Sequence CCTCAGCTGCAGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968846115_968846120 0 Left 968846115 4:3042416-3042438 CCCTCTCCTCTGTGCCTCACTGT No data
Right 968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG No data
968846114_968846120 1 Left 968846114 4:3042415-3042437 CCCCTCTCCTCTGTGCCTCACTG No data
Right 968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG No data
968846116_968846120 -1 Left 968846116 4:3042417-3042439 CCTCTCCTCTGTGCCTCACTGTC 0: 1
1: 2
2: 8
3: 97
4: 781
Right 968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG No data
968846113_968846120 19 Left 968846113 4:3042397-3042419 CCGCGGCGGGACTCTGGACCCCT No data
Right 968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG No data
968846117_968846120 -6 Left 968846117 4:3042422-3042444 CCTCTGTGCCTCACTGTCCTCAG No data
Right 968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968846120 Original CRISPR CCTCAGCTGCAGAATGAAGA TGG Intergenic
No off target data available for this crispr