ID: 968848867

View in Genome Browser
Species Human (GRCh38)
Location 4:3063989-3064011
Sequence ACTCTTGGTGGCTCCTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968848861_968848867 20 Left 968848861 4:3063946-3063968 CCTGAGAACTTCCTGGGTGAGCA No data
Right 968848867 4:3063989-3064011 ACTCTTGGTGGCTCCTGGATAGG No data
968848858_968848867 28 Left 968848858 4:3063938-3063960 CCTAAAATCCTGAGAACTTCCTG No data
Right 968848867 4:3063989-3064011 ACTCTTGGTGGCTCCTGGATAGG No data
968848862_968848867 9 Left 968848862 4:3063957-3063979 CCTGGGTGAGCATCTTTTGTTCT No data
Right 968848867 4:3063989-3064011 ACTCTTGGTGGCTCCTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968848867 Original CRISPR ACTCTTGGTGGCTCCTGGAT AGG Intergenic