ID: 968850108

View in Genome Browser
Species Human (GRCh38)
Location 4:3073347-3073369
Sequence AGAGCCTCCTGCCTTTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850108_968850122 24 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850122 4:3073394-3073416 GGCCTGTGTCCCAGGCGTGAGGG No data
968850108_968850121 23 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850108_968850125 26 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850125 4:3073396-3073418 CCTGTGTCCCAGGCGTGAGGGGG No data
968850108_968850118 16 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850118 4:3073386-3073408 CCCGCCACGGCCTGTGTCCCAGG No data
968850108_968850123 25 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850108_968850113 3 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850113 4:3073373-3073395 GACCAGGACCCTGCCCGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850108 Original CRISPR AGAGCCTCCTGCCTTTTGGG TGG (reversed) Intergenic