ID: 968850111

View in Genome Browser
Species Human (GRCh38)
Location 4:3073351-3073373
Sequence CTCCAGAGCCTCCTGCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850111_968850118 12 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850118 4:3073386-3073408 CCCGCCACGGCCTGTGTCCCAGG No data
968850111_968850113 -1 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850113 4:3073373-3073395 GACCAGGACCCTGCCCGCCACGG No data
968850111_968850121 19 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850111_968850123 21 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850111_968850122 20 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850122 4:3073394-3073416 GGCCTGTGTCCCAGGCGTGAGGG No data
968850111_968850125 22 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850125 4:3073396-3073418 CCTGTGTCCCAGGCGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850111 Original CRISPR CTCCAGAGCCTCCTGCCTTT TGG (reversed) Intergenic