ID: 968850114

View in Genome Browser
Species Human (GRCh38)
Location 4:3073375-3073397
Sequence GGCCGTGGCGGGCAGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850114_968850125 -2 Left 968850114 4:3073375-3073397 CCAGGACCCTGCCCGCCACGGCC No data
Right 968850125 4:3073396-3073418 CCTGTGTCCCAGGCGTGAGGGGG No data
968850114_968850121 -5 Left 968850114 4:3073375-3073397 CCAGGACCCTGCCCGCCACGGCC No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850114_968850123 -3 Left 968850114 4:3073375-3073397 CCAGGACCCTGCCCGCCACGGCC No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850114_968850122 -4 Left 968850114 4:3073375-3073397 CCAGGACCCTGCCCGCCACGGCC No data
Right 968850122 4:3073394-3073416 GGCCTGTGTCCCAGGCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850114 Original CRISPR GGCCGTGGCGGGCAGGGTCC TGG (reversed) Intergenic