ID: 968850115

View in Genome Browser
Species Human (GRCh38)
Location 4:3073381-3073403
Sequence GACACAGGCCGTGGCGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850115_968850123 -9 Left 968850115 4:3073381-3073403 CCCTGCCCGCCACGGCCTGTGTC No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850115_968850122 -10 Left 968850115 4:3073381-3073403 CCCTGCCCGCCACGGCCTGTGTC No data
Right 968850122 4:3073394-3073416 GGCCTGTGTCCCAGGCGTGAGGG No data
968850115_968850125 -8 Left 968850115 4:3073381-3073403 CCCTGCCCGCCACGGCCTGTGTC No data
Right 968850125 4:3073396-3073418 CCTGTGTCCCAGGCGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850115 Original CRISPR GACACAGGCCGTGGCGGGCA GGG (reversed) Intergenic