ID: 968850116

View in Genome Browser
Species Human (GRCh38)
Location 4:3073382-3073404
Sequence GGACACAGGCCGTGGCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850116_968850125 -9 Left 968850116 4:3073382-3073404 CCTGCCCGCCACGGCCTGTGTCC No data
Right 968850125 4:3073396-3073418 CCTGTGTCCCAGGCGTGAGGGGG No data
968850116_968850123 -10 Left 968850116 4:3073382-3073404 CCTGCCCGCCACGGCCTGTGTCC No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850116 Original CRISPR GGACACAGGCCGTGGCGGGC AGG (reversed) Intergenic