ID: 968850121

View in Genome Browser
Species Human (GRCh38)
Location 4:3073393-3073415
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850106_968850121 29 Left 968850106 4:3073341-3073363 CCTCTACCACCCAAAAGGCAGGA No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850110_968850121 20 Left 968850110 4:3073350-3073372 CCCAAAAGGCAGGAGGCTCTGGA 0: 1
1: 0
2: 2
3: 22
4: 216
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850114_968850121 -5 Left 968850114 4:3073375-3073397 CCAGGACCCTGCCCGCCACGGCC No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850111_968850121 19 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850108_968850121 23 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data
968850104_968850121 30 Left 968850104 4:3073340-3073362 CCCTCTACCACCCAAAAGGCAGG No data
Right 968850121 4:3073393-3073415 CGGCCTGTGTCCCAGGCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr