ID: 968850123

View in Genome Browser
Species Human (GRCh38)
Location 4:3073395-3073417
Sequence GCCTGTGTCCCAGGCGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850111_968850123 21 Left 968850111 4:3073351-3073373 CCAAAAGGCAGGAGGCTCTGGAG No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850116_968850123 -10 Left 968850116 4:3073382-3073404 CCTGCCCGCCACGGCCTGTGTCC No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850114_968850123 -3 Left 968850114 4:3073375-3073397 CCAGGACCCTGCCCGCCACGGCC No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850110_968850123 22 Left 968850110 4:3073350-3073372 CCCAAAAGGCAGGAGGCTCTGGA 0: 1
1: 0
2: 2
3: 22
4: 216
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850115_968850123 -9 Left 968850115 4:3073381-3073403 CCCTGCCCGCCACGGCCTGTGTC No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data
968850108_968850123 25 Left 968850108 4:3073347-3073369 CCACCCAAAAGGCAGGAGGCTCT No data
Right 968850123 4:3073395-3073417 GCCTGTGTCCCAGGCGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850123 Original CRISPR GCCTGTGTCCCAGGCGTGAG GGG Intergenic
No off target data available for this crispr