ID: 968850617

View in Genome Browser
Species Human (GRCh38)
Location 4:3075126-3075148
Sequence GTCCCAGGCTACGGCGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850603_968850617 3 Left 968850603 4:3075100-3075122 CCCGCTGCAGCTCCCTGTCCCGG 0: 1
1: 0
2: 3
3: 48
4: 384
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135
968850609_968850617 -9 Left 968850609 4:3075112-3075134 CCCTGTCCCGGCGGGTCCCAGGC 0: 1
1: 0
2: 1
3: 9
4: 129
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135
968850598_968850617 28 Left 968850598 4:3075075-3075097 CCGCTGCACCGACCGTGAGTTTG 0: 1
1: 0
2: 0
3: 2
4: 90
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135
968850605_968850617 2 Left 968850605 4:3075101-3075123 CCGCTGCAGCTCCCTGTCCCGGC 0: 1
1: 0
2: 2
3: 37
4: 447
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135
968850602_968850617 16 Left 968850602 4:3075087-3075109 CCGTGAGTTTGGGCCCGCTGCAG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135
968850610_968850617 -10 Left 968850610 4:3075113-3075135 CCTGTCCCGGCGGGTCCCAGGCT 0: 1
1: 0
2: 1
3: 10
4: 198
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135
968850601_968850617 20 Left 968850601 4:3075083-3075105 CCGACCGTGAGTTTGGGCCCGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG 0: 1
1: 0
2: 3
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850617 Original CRISPR GTCCCAGGCTACGGCGGGGA TGG Intronic
900376894 1:2359034-2359056 GCCCCAGGCTAGGGCAGGGGTGG - Intronic
900565888 1:3331700-3331722 GTGCCAGGCAACGGGGAGGAAGG - Intronic
904686580 1:32265319-32265341 GTCCCAGGCTAGTGCCGGGGAGG - Intronic
906321684 1:44821155-44821177 GTCCTAAGCTATGGCTGGGAAGG + Intronic
907965387 1:59323899-59323921 GTCAAAGTCTACGGCGGGGGAGG + Intronic
912561728 1:110555924-110555946 GTGCCCAGCTACAGCGGGGAAGG - Intergenic
913047921 1:115089489-115089511 GCGGCAGGCTCCGGCGGGGAGGG + Intronic
915339317 1:155167571-155167593 GACACAGCCTAGGGCGGGGAGGG - Intergenic
916912698 1:169367905-169367927 GCCCCAGGCGACAGCGTGGAGGG - Exonic
917904468 1:179575635-179575657 GTCCGAGGCTCCGGCGAGGAGGG - Exonic
922496512 1:226062262-226062284 GTCTCGGGCCGCGGCGGGGAGGG - Intronic
922801242 1:228365660-228365682 GTCCCAGGCTGGGGCAGGGCTGG - Intronic
924775259 1:247111638-247111660 GGCCCCGGCACCGGCGGGGAGGG - Exonic
1062855427 10:777567-777589 GTCACAGCCCACGCCGGGGAAGG - Intergenic
1064244196 10:13656556-13656578 GTCAAGGGCTACCGCGGGGAAGG - Intronic
1069873130 10:71545246-71545268 CTCCCAGGCCACGGCAGGGGAGG + Intronic
1070811889 10:79302249-79302271 GTCCCAAACTCAGGCGGGGATGG - Intronic
1075388141 10:122072433-122072455 CTCCCAGGCTTCTGTGGGGAGGG + Intronic
1075999801 10:126905600-126905622 AGCCCAGGCTCCGGCGGGGCGGG + Intronic
1076112614 10:127872497-127872519 CTCCCAGGCTCCAGCGGTGATGG - Intergenic
1076115781 10:127898361-127898383 TTTCCAGGCTACGGTGTGGAAGG - Intergenic
1077468263 11:2744033-2744055 GTCCCAAGCTACGTGGGTGAGGG - Intronic
1079367605 11:19822929-19822951 GCCCCAGGGTACAGCAGGGAAGG - Intronic
1081688078 11:45056556-45056578 TTCCCAGGGTACAGGGGGGAGGG + Intergenic
1084659891 11:70540474-70540496 CTCCCAGGCTCCCGCGGGCAGGG - Intronic
1085284232 11:75349831-75349853 GGCCCAGGCTTTGGGGGGGACGG - Intronic
1085459130 11:76682604-76682626 GTCACAGGCTGCTGGGGGGAAGG + Intergenic
1088707222 11:112474709-112474731 GTCACCGGCTTCAGCGGGGATGG + Intergenic
1089498395 11:118919143-118919165 CTTCCAGGCTAGGGAGGGGATGG - Intronic
1090647429 11:128777142-128777164 TTCTCAGGCCAAGGCGGGGAAGG + Intronic
1096078272 12:48818177-48818199 GTCCCAGGCGACAGCAGGGCGGG - Intronic
1096143995 12:49265222-49265244 GTCCCAGGGGACGGCGGGCCCGG + Intronic
1096365523 12:51026029-51026051 GTCCTAGGCCGCGGCGGGGAAGG + Intronic
1096469897 12:51869378-51869400 GCCCCAGGCTACGGCGGGGGAGG - Intergenic
1096648474 12:53050473-53050495 GGCCCAGGCTAGAGCAGGGAAGG - Intronic
1102490932 12:113289098-113289120 GACCCAGGCTACTGTGGGGGTGG - Intronic
1122299374 14:100723274-100723296 GTCCCGGGCACCAGCGGGGATGG - Intergenic
1122600275 14:102917893-102917915 GGCCCAGCCTAGGACGGGGAGGG - Intergenic
1202865574 14_GL000225v1_random:114949-114971 GCCCCAGGCTTCCACGGGGAGGG + Intergenic
1123486792 15:20747887-20747909 GTCCCATGCTAGGCCGGGCATGG - Intergenic
1123543282 15:21316940-21316962 GTCCCATGCTAGGCCGGGCATGG - Intergenic
1125462686 15:39921004-39921026 CGCCCAGGCTGCCGCGGGGAGGG + Intergenic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1129840577 15:78740919-78740941 GTACCAGGATGTGGCGGGGAAGG - Intergenic
1131180043 15:90233485-90233507 GCCTCAGGCGAGGGCGGGGAGGG + Intronic
1202951601 15_KI270727v1_random:44069-44091 GTCCCATGCTAGGCCGGGCATGG - Intergenic
1132677999 16:1128622-1128644 TGCCCAGGCTACGGCGAGGCTGG - Intergenic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1133020138 16:2963552-2963574 GTCCCAGGGAAGGGCGGGGCAGG + Intergenic
1133775008 16:8889200-8889222 GGGCCAGGCTACGGCAGGGCCGG + Intergenic
1133999248 16:10769986-10770008 GTCCTAGGGAAGGGCGGGGAGGG - Intronic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1137562060 16:49509246-49509268 GTCCCAGGGGACAGCAGGGATGG - Intronic
1137610647 16:49815002-49815024 CTCCCAAGCCACGTCGGGGAGGG + Intronic
1137618203 16:49858855-49858877 ATCCCAGGCGCCGGCGGGGGTGG - Intergenic
1137852609 16:51761777-51761799 GTCTCTGGCTACTGGGGGGAAGG - Intergenic
1139383578 16:66549799-66549821 CTCCCCGGCTGCGGCTGGGACGG - Intronic
1139461483 16:67126267-67126289 TTCCCAGGCTCCAGAGGGGAAGG + Intronic
1139510787 16:67427376-67427398 GTCCCAGGCAAAGGCTGGGAGGG + Intergenic
1139810576 16:69613148-69613170 ATCACTGGCTACGGTGGGGAAGG - Intronic
1141766440 16:86062747-86062769 GTCCCTGGCGAAGGCCGGGATGG + Intergenic
1142273298 16:89102284-89102306 GTCCCAGGCTTGGGCAGGGGCGG + Intronic
1143453914 17:7053582-7053604 GTCTCAGGCTGAGGCTGGGAAGG - Intergenic
1144627802 17:16853867-16853889 GCCCCTGGCTGCGGCGGGGATGG - Intergenic
1144643203 17:16950764-16950786 GTCCCAGGCGGGGGAGGGGAGGG - Intronic
1145159396 17:20564468-20564490 GCCCCTGGCTGCAGCGGGGATGG - Intergenic
1145255942 17:21322416-21322438 GGCTCAGGCCACGGCAGGGATGG + Intergenic
1145320680 17:21765529-21765551 GGCTCAGGCCACGGCAGGGATGG - Intergenic
1147563601 17:41523466-41523488 GTCCCAGGAAAGGGAGGGGAGGG - Intergenic
1148082980 17:44977685-44977707 GACCCTGGCCAGGGCGGGGATGG + Intergenic
1149597961 17:57875174-57875196 ACCCCAGGCTACAGCAGGGAGGG + Intronic
1151755336 17:76072451-76072473 GTCCCAGGCGGCGGCGGCGGCGG - Exonic
1158484805 18:57856921-57856943 TTCCCAGGCTACCGCAGAGAAGG - Intergenic
1160688780 19:450638-450660 GACCCAGGCCACGGCACGGACGG - Intronic
1160710145 19:547645-547667 GACCCAGGCTGCGGTGTGGAAGG - Intronic
1162555489 19:11383520-11383542 GTCCTAGGCTGGGGCGGGGCTGG - Intronic
1163113795 19:15177687-15177709 AGCCCAGGCTGCGGCTGGGACGG - Exonic
1163392655 19:17039680-17039702 GTCCCAGGGTAGGGCAGGGATGG - Intergenic
1165949365 19:39465338-39465360 GTCACTGGCTACAGCAGGGATGG + Intronic
1166329432 19:42069757-42069779 GGCCCAGGCTCCAGGGGGGAGGG - Intronic
925610258 2:5696387-5696409 GACCCAGGCTACGAGCGGGAGGG + Exonic
926629402 2:15123089-15123111 CTCCCAGGCTACCTCGGGGTGGG - Intergenic
927172143 2:20379240-20379262 GGCCCAGGCAAAGGCTGGGAGGG - Intergenic
927658521 2:24972028-24972050 CTGCCAGGCAGCGGCGGGGATGG - Exonic
929909957 2:46081452-46081474 CACACAGACTACGGCGGGGAGGG + Intronic
931382245 2:61764615-61764637 GCCCTAGGCTACGCCGGGAACGG - Intergenic
932765210 2:74464969-74464991 GTCCGGGGCCACGGCGGGGCTGG + Exonic
1172320710 20:33993630-33993652 GTCCAGAGCTTCGGCGGGGACGG - Intronic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1174377941 20:50138821-50138843 GTCCCAGTGTTCTGCGGGGAAGG - Intronic
1176412652 21:6457419-6457441 GTCCCAGGCAGGGGCGGGGCAGG - Intergenic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1176426870 21:6553485-6553507 CTCCCAGGCCAGGGCTGGGAAGG - Intergenic
1179548752 21:42129492-42129514 GGCCCAGGCGTCAGCGGGGAAGG - Intronic
1179688146 21:43065741-43065763 GTCCCAGGCAGGGGCGGGGCAGG - Intronic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1179702361 21:43161807-43161829 CTCCCAGGCCAGGGCTGGGAAGG - Intronic
1181754840 22:25016523-25016545 GGCCCAGACTAAGGCAGGGAGGG + Intronic
1184773050 22:46609254-46609276 GACCCAGGCTCCTGCGCGGAGGG - Intronic
950633186 3:14297820-14297842 GGGCCAGGCTGCGGCGGGGACGG - Intergenic
954363545 3:50134706-50134728 GCCCCAGGCTAGGGCTGGGGAGG + Intergenic
954995340 3:54876166-54876188 GTCCCCACCTAAGGCGGGGAGGG - Intronic
961352175 3:126311055-126311077 GTCCCAGGCTGGGGCTGGGGAGG + Intergenic
962853848 3:139327352-139327374 TTGCCAGGCTACCACGGGGAGGG + Intronic
964645742 3:158956836-158956858 GTCCCAGGCAGCAGTGGGGAGGG + Intergenic
967242730 3:187456904-187456926 GTCCCAGGCTCAGGTGGGGATGG - Intergenic
968745827 4:2359619-2359641 GTCCCAGACTACTGCGTGGCAGG - Intronic
968764316 4:2460037-2460059 ATCCCCGGCTACGGCCTGGAAGG + Exonic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
969057856 4:4413410-4413432 GCCCCAGCCTAGGGCGTGGACGG - Intronic
974047306 4:56908461-56908483 GTCCCAGCCTCCAGTGGGGAGGG - Intronic
975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG + Exonic
978727140 4:111982834-111982856 TTCTCAGGCTACGGTGGGGTAGG - Intergenic
979228081 4:118313274-118313296 GTTCCAGGCGACAGTGGGGAAGG - Exonic
981172005 4:141636430-141636452 GCCCCAGGCCCCGGCAGGGACGG + Intergenic
981923998 4:150117633-150117655 TTCCCAGACTCCAGCGGGGATGG - Intronic
985120142 4:186631807-186631829 GCACCAGGATACAGCGGGGATGG - Intronic
985655506 5:1129549-1129571 GTCCCAGGCGACAGGGTGGAGGG + Intergenic
985665719 5:1180724-1180746 GCTCCAGGCTCCAGCGGGGAGGG - Intergenic
986851427 5:11817706-11817728 TCCACAGGTTACGGCGGGGATGG + Intronic
992130962 5:73692687-73692709 GTCCCAGCCTTCTGCAGGGAGGG + Intronic
994353979 5:98774425-98774447 GTCCGAGCCGAAGGCGGGGAGGG - Intronic
997285799 5:132677432-132677454 GTCCAGGGCCACGGCAGGGATGG + Intronic
998200469 5:140114260-140114282 GGCTCAGGCTCCGGCGGGGGCGG + Exonic
998205463 5:140154161-140154183 GTCCCAGGCTGAGGTGGGAAAGG + Intergenic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1012889796 6:104885403-104885425 GACGCCGGCTACAGCGGGGAAGG + Intergenic
1015788665 6:136944520-136944542 GATCCAGGCCAAGGCGGGGATGG - Intergenic
1017672415 6:156779291-156779313 GTCCCAGGCGGCGGCGGCGGGGG + Exonic
1019536167 7:1530921-1530943 GGCCCGGGCCGCGGCGGGGACGG + Intronic
1026122543 7:67550378-67550400 GACCTAGGCTAGGGAGGGGAAGG - Intergenic
1030072973 7:105713460-105713482 GGCCCAGGCTACTGCAGAGAGGG + Intronic
1039269306 8:35863529-35863551 CTCCAAGGCTATGGCTGGGAAGG - Intergenic
1042962870 8:74321501-74321523 GGCCCAGGCGGCGGCGGCGAAGG - Intronic
1049542380 8:143214497-143214519 GTCCCTGGCTAGGGAGGGGCCGG - Intergenic
1049585085 8:143429307-143429329 GTCCCCGGCGACGGCGGCGCGGG + Exonic
1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG + Intergenic
1052834053 9:33237292-33237314 GTCCCAGGTTACAGTGAGGAAGG - Intronic
1053142670 9:35690933-35690955 GAGCCGGGCTGCGGCGGGGAAGG + Exonic
1056581278 9:87889352-87889374 TTCCCAGGCTACCACGGGGCAGG - Intergenic
1057996280 9:99823752-99823774 GTCCCAGGCAAAGGGGTGGATGG - Intronic
1060191788 9:121598543-121598565 GGCCCAGGCGAGGGCGCGGAAGG - Intronic
1061712745 9:132499034-132499056 GTCCCTGCCGGCGGCGGGGAAGG - Intronic
1062106417 9:134757394-134757416 GTCCCAGGCCACGGGGGGCAGGG + Intronic
1062445957 9:136594853-136594875 GTGCCAGGCTGGGGAGGGGACGG + Intergenic
1062504380 9:136865827-136865849 GTGCCAGGGTGGGGCGGGGAGGG - Intronic
1190938851 X:55020838-55020860 GTCCAATGCTATGGAGGGGAAGG - Intronic
1200056718 X:153465440-153465462 GACCCAGGCGAGGCCGGGGAGGG - Intronic
1200202963 X:154295290-154295312 AGCCCAGGCTATGGCGGGCAGGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic