ID: 968850653

View in Genome Browser
Species Human (GRCh38)
Location 4:3075245-3075267
Sequence GGGGAAGGCCTCGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968850653_968850661 4 Left 968850653 4:3075245-3075267 CCTCCTGGGGCGAGGCCTTCCCC 0: 1
1: 0
2: 5
3: 20
4: 260
Right 968850661 4:3075272-3075294 TCAGCCCCGCTCCCTCACTTGGG 0: 1
1: 1
2: 2
3: 31
4: 231
968850653_968850667 27 Left 968850653 4:3075245-3075267 CCTCCTGGGGCGAGGCCTTCCCC 0: 1
1: 0
2: 5
3: 20
4: 260
Right 968850667 4:3075295-3075317 TCTTCCCTTGTCCTCTCGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 78
968850653_968850668 28 Left 968850653 4:3075245-3075267 CCTCCTGGGGCGAGGCCTTCCCC 0: 1
1: 0
2: 5
3: 20
4: 260
Right 968850668 4:3075296-3075318 CTTCCCTTGTCCTCTCGCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
968850653_968850669 29 Left 968850653 4:3075245-3075267 CCTCCTGGGGCGAGGCCTTCCCC 0: 1
1: 0
2: 5
3: 20
4: 260
Right 968850669 4:3075297-3075319 TTCCCTTGTCCTCTCGCGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 56
968850653_968850660 3 Left 968850653 4:3075245-3075267 CCTCCTGGGGCGAGGCCTTCCCC 0: 1
1: 0
2: 5
3: 20
4: 260
Right 968850660 4:3075271-3075293 TTCAGCCCCGCTCCCTCACTTGG 0: 1
1: 0
2: 1
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968850653 Original CRISPR GGGGAAGGCCTCGCCCCAGG AGG (reversed) Intronic
900159462 1:1216580-1216602 GGGGCAGGCCTAGCCCCAGATGG - Intergenic
900322396 1:2091554-2091576 GGGCACTGCCTCGCCCCAAGAGG - Intronic
900989291 1:6090621-6090643 GGGGCAGGCCTCCCCTCAGTAGG + Intronic
901914037 1:12484205-12484227 TGGGAAGGCCTGGCCCAAGCAGG - Intronic
902079771 1:13813035-13813057 GGAGAAGTCATCACCCCAGGAGG - Intronic
902317434 1:15633009-15633031 GGGGATGGCCTGAGCCCAGGAGG - Intronic
902799696 1:18821523-18821545 GAGGAAGGCCAGGCCACAGGTGG + Intergenic
903067885 1:20710977-20710999 AGGGCAGGTCTCGGCCCAGGCGG + Intronic
903129359 1:21268648-21268670 AGGGAAGCCCTCGCCTCAGCAGG + Intronic
904221357 1:28972339-28972361 TGGGAGGGCCTGGGCCCAGGTGG + Intronic
905897891 1:41560619-41560641 GGTGAAGTCCTGGCCCCGGGAGG - Intronic
906060399 1:42944687-42944709 GAAGAAGGCTTCGGCCCAGGAGG + Intronic
906314276 1:44776163-44776185 GGGGAAGGCGACCTCCCAGGCGG - Intronic
906322743 1:44827100-44827122 GCTGAAGGCCTGGGCCCAGGAGG + Intronic
908531847 1:65041252-65041274 GGGGAAGGGCTCATCCCAGTGGG + Intergenic
912438918 1:109683358-109683380 GAAGAAGGCCAGGCCCCAGGTGG - Intronic
912441440 1:109701803-109701825 GAAGAAGGCCAGGCCCCAGGTGG - Intronic
914201469 1:145488719-145488741 GAGGAGTGCCACGCCCCAGGAGG - Intergenic
914480591 1:148061846-148061868 GAGGAGTGCCACGCCCCAGGAGG - Intergenic
914989121 1:152482998-152483020 GGGGAAGGCCTTCACCCAGCTGG + Intergenic
915146466 1:153798529-153798551 GGGGAAGGGGTCGGCCCGGGTGG + Intergenic
915685303 1:157626176-157626198 GGGCAGGGCCTCCTCCCAGGGGG - Intergenic
920125687 1:203692265-203692287 GAGGATGGCCTCAGCCCAGGAGG - Intronic
920415223 1:205795056-205795078 GGAGAAGACCTGGCCCCAGAAGG + Intronic
920849786 1:209620987-209621009 GAGAGAGGCCTGGCCCCAGGGGG - Intronic
924507897 1:244703443-244703465 GGGGATTGCCTGGGCCCAGGAGG - Intronic
924787266 1:247210400-247210422 GGGGAGAGCCCCGACCCAGGAGG - Intergenic
1066453648 10:35553732-35553754 GGGGAGGGCATCGCCCTTGGGGG + Intronic
1068749595 10:60576822-60576844 GGGGAAACCCTTGCCACAGGTGG - Intronic
1069038113 10:63666499-63666521 GAGGAAGGCTTGGGCCCAGGAGG + Intergenic
1069701776 10:70432095-70432117 GGTGAAGGCCTTGCCCTGGGTGG - Intergenic
1070586614 10:77771553-77771575 GAGGAAGGCCCAGCCCCAGTCGG + Intergenic
1072656768 10:97335019-97335041 GAGGGAGGCCGCGGCCCAGGAGG - Intergenic
1073376835 10:103042360-103042382 GGGAAAGGCCTGGCAGCAGGTGG - Intronic
1075811484 10:125227789-125227811 GGTCAAGGCCTGCCCCCAGGAGG - Intergenic
1075981850 10:126747017-126747039 GCAGAAGGCCTGGCTCCAGGTGG + Intergenic
1076256632 10:129031701-129031723 CGGGAAGCCATCCCCCCAGGAGG + Intergenic
1076741179 10:132486474-132486496 GTGGACGGCCTCTCCCCCGGCGG - Intergenic
1076911825 10:133394261-133394283 GGGGAAGTTCTCCCGCCAGGCGG - Exonic
1077032914 11:477766-477788 GGGGCAGCCCTCGCCCCACAAGG - Intronic
1077116196 11:885680-885702 GGTGGAGGCCTCGGCCCAGAGGG - Intronic
1077155574 11:1089447-1089469 GGGGAAGTCCTGGCTCCATGAGG + Intergenic
1077355496 11:2114917-2114939 GGGGAAGGCCTCGCCCAAGCTGG + Intergenic
1078509357 11:11974062-11974084 GGGGAAGGCCCTGGCCCTGGAGG - Intronic
1081775590 11:45674217-45674239 GAGGAAGGCCCTGCCCCAGCTGG + Intergenic
1082099756 11:48162742-48162764 GGGACAGGACTCGCCCCAGCTGG + Intronic
1082633012 11:55562664-55562686 GGGAAAGGCCTCGACCCATCCGG - Intergenic
1083144994 11:60751440-60751462 GGGGAAGGACCAGCCCCATGTGG - Intergenic
1083302299 11:61745484-61745506 GAGGAAGGCCTGCTCCCAGGAGG - Exonic
1084564277 11:69920525-69920547 GAGGGAGGACTCACCCCAGGAGG - Intergenic
1084652264 11:70496114-70496136 GGGGAAGGCCTGGGCGCAGGTGG + Intronic
1085391798 11:76185922-76185944 GGGAAAGGCCTCGTGCCTGGAGG - Intergenic
1086380280 11:86245180-86245202 GGCGGAGGCCCCGCCCCAGGCGG + Exonic
1086384426 11:86292667-86292689 TGGGAGGGCCTGGGCCCAGGAGG - Intergenic
1089368085 11:117933161-117933183 AAGGAAGGCCTCTTCCCAGGGGG + Intergenic
1090395750 11:126416862-126416884 GGGGCCGGCCTCGCCTGAGGCGG - Intronic
1091224983 11:133951698-133951720 CGGGCAGGCCTCTGCCCAGGTGG - Intronic
1091439547 12:501968-501990 GGGGAAGGCCCTGCCTCAGCTGG - Intronic
1091451708 12:576227-576249 CGGGGAGGCCTCGCCCCACGTGG - Intronic
1091749903 12:3015743-3015765 GAGGATGGCCTCAGCCCAGGAGG - Intronic
1091974457 12:4813424-4813446 GGGGAAGGCCTTGCCTATGGGGG - Intronic
1093752646 12:22818363-22818385 GGGGCTGGCCTAGCCCAAGGGGG + Intergenic
1097267603 12:57755191-57755213 GGGGGCGGCCCCGCCGCAGGAGG + Exonic
1101462105 12:104906462-104906484 GGGGCAGGCCTCAGACCAGGGGG + Intronic
1101730854 12:107425893-107425915 GGGGAAAGCCTCCACCCAGTTGG + Intronic
1102587993 12:113936575-113936597 GGGGAAGCCGTGGCCCCTGGGGG - Intronic
1103400843 12:120641548-120641570 GGGGAGGGCCTTGCCCCAAGAGG - Intronic
1104343208 12:127971335-127971357 GGGAAAGGCCTGCCCCCATGGGG - Intergenic
1104763834 12:131313858-131313880 GGGGGTGGCCCAGCCCCAGGAGG + Intergenic
1104828151 12:131729412-131729434 GAGGATGGCTTAGCCCCAGGAGG + Intronic
1104980373 12:132570803-132570825 GGGGGAGGCCTGGCCCCAGGAGG - Intronic
1105506942 13:21018462-21018484 GGGGAAGGGCTGGCTCCAGCTGG + Intronic
1108518544 13:51224013-51224035 GAGGAAGTCCTGGACCCAGGGGG + Intronic
1109798218 13:67343386-67343408 GGGGAAGGCCTCCACCCAGCTGG + Intergenic
1113675603 13:112204932-112204954 CAGCAAGGCCTCGCCGCAGGGGG + Intergenic
1115828992 14:37313400-37313422 GGGCAAGGCCTGGCACCTGGAGG + Intronic
1116958146 14:50944539-50944561 GGGGACGGCACCGCCCGAGGGGG - Exonic
1120228220 14:81814599-81814621 GGGAAAGGCAGCACCCCAGGTGG - Intergenic
1122955322 14:105067718-105067740 TGGGAAGGCCTGGGCCCAGGGGG + Intergenic
1124651009 15:31473915-31473937 GGGCAAGGCCCCTGCCCAGGAGG - Intergenic
1126076753 15:44918876-44918898 GGAGAAGGCGTGACCCCAGGAGG - Intergenic
1127469409 15:59276905-59276927 AGGGTAGGCCTGGCCCCACGCGG + Intronic
1127977251 15:64006816-64006838 GGGGAAGGCCTGGCAGCTGGAGG + Intronic
1128416812 15:67454177-67454199 GGGCAAGGCATCGCCCCACCTGG - Intronic
1128775002 15:70313564-70313586 GGGGCAGGCATGGGCCCAGGTGG - Intergenic
1129670646 15:77606013-77606035 GGGCGAGGACTCCCCCCAGGTGG + Intergenic
1130066556 15:80609568-80609590 GGGGGACGCCTCGCCCTAGATGG + Intergenic
1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG + Intergenic
1131109882 15:89758519-89758541 TGTGAAGGCCTCACCCCAGTGGG - Intergenic
1131329834 15:91486784-91486806 GGGGAAGCCCTGGCCCCTGAAGG + Intergenic
1132686221 16:1163249-1163271 GGGGGTGGCCTCGGCCCAGCAGG + Intronic
1132779594 16:1615045-1615067 GAGGAACCCCTCGCCCCAGCCGG + Intronic
1133345886 16:5070219-5070241 GGGGAGTGACTCGCCCGAGGTGG + Intronic
1136566992 16:31076557-31076579 GGAGAAGTCCTTGCCACAGGTGG - Exonic
1137730825 16:50688262-50688284 GGGGCAGTCCTCGCTCCTGGGGG + Intergenic
1138443435 16:57048461-57048483 TGGGAAGGCCACACTCCAGGGGG - Intronic
1138505868 16:57478021-57478043 GGGCAAGGCCTCAGCCCAGCTGG + Intronic
1139465192 16:67150572-67150594 GCGGGAGGCCACGCCCCGGGGGG + Exonic
1140475248 16:75236662-75236684 GGAGAAGGCCTCGCAACAGGCGG + Intronic
1141831406 16:86511611-86511633 GTGGAGGGGCTCGCCCCAGCTGG - Intronic
1142150368 16:88509981-88510003 GGTGAAGGCCAAGTCCCAGGGGG + Intronic
1142230594 16:88898429-88898451 GGGAGTGGCCTGGCCCCAGGTGG - Intronic
1142375041 16:89702167-89702189 GGGGATGGCCCCGCCCCACAGGG - Intergenic
1142753074 17:1999908-1999930 GGGGCAGGCCTGTCCCCAGGGGG + Intronic
1143491948 17:7289935-7289957 GGGGAAGACCAAGCCCCAGCAGG + Intronic
1143954460 17:10657567-10657589 TGGGATGGCCTCACTCCAGGAGG + Intergenic
1144788343 17:17844157-17844179 GGGGCTGGCCTGGCCCCAGGTGG + Intronic
1145916669 17:28577949-28577971 GTACAAGGCCTGGCCCCAGGAGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG + Intergenic
1148053237 17:44779471-44779493 GGGGAGGGCCTGGCCGCAGCAGG - Intronic
1148740471 17:49889902-49889924 GGGGCAGGCCTGGCTCCAGGAGG + Intergenic
1148899982 17:50867724-50867746 GGGGAAGGCGGCGCCCCAACTGG - Intronic
1149496346 17:57120270-57120292 GGGCAAGGCCTCGCTCCACCAGG - Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149875522 17:60228732-60228754 GAGGATGGCCTCAACCCAGGGGG + Intronic
1150005695 17:61467666-61467688 GGGGGCTGCCTGGCCCCAGGAGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150409961 17:64934810-64934832 CTAGAAGGCTTCGCCCCAGGAGG - Intergenic
1151324301 17:73369394-73369416 GAGGAAGGCCTCGGCCAAGACGG + Intronic
1151822955 17:76506956-76506978 GGGGAAGGAATAGCACCAGGAGG - Intergenic
1152595542 17:81236062-81236084 GAGGGAGGCCTGGCTCCAGGTGG - Intronic
1157514018 18:48298325-48298347 GGGGCAGGTCTGTCCCCAGGAGG - Intronic
1160185840 18:76675472-76675494 GGGGAAGATATGGCCCCAGGTGG - Intergenic
1160345381 18:78127974-78127996 CAGTAAGTCCTCGCCCCAGGTGG - Intergenic
1160685097 19:430923-430945 GGGGAAGGCCACGGCAGAGGTGG - Intronic
1160790298 19:919934-919956 GGGGAAGGCCTCACTGCAGTAGG - Exonic
1162378977 19:10321034-10321056 GGGCAGGGCCTTACCCCAGGGGG + Exonic
1162461377 19:10816123-10816145 GGGGAAGCCTCCACCCCAGGGGG - Intronic
1162567646 19:11453124-11453146 GGCCAAGGCCTCGGCCCAGGGGG + Exonic
1163210112 19:15834054-15834076 GGGAAAGGCCTCGACCCATCCGG - Intergenic
1163522546 19:17800000-17800022 GGGGCAGATCTAGCCCCAGGTGG + Intronic
1164759413 19:30717570-30717592 GGGGAAGCCATGGCTCCAGGGGG + Intergenic
1165749919 19:38253393-38253415 GGGGAAGGGGCCGCCCCAGCTGG - Intronic
1167601807 19:50459110-50459132 GGGAAAGCCCCGGCCCCAGGTGG + Exonic
1168339862 19:55616677-55616699 GGCGAAGCCCTCGCCGCAGGAGG - Exonic
1168687264 19:58356448-58356470 GCGGAAGGCCTTGCCGCAGTCGG + Exonic
925281651 2:2689567-2689589 GGGGAAGGTCCCTGCCCAGGCGG - Intergenic
926018575 2:9474960-9474982 GGGAAAGGCCGCTGCCCAGGAGG - Intronic
926185628 2:10688546-10688568 GGGGAAGGCCTCTCTACAAGAGG - Intronic
927871223 2:26625317-26625339 AGGAAAGGCCTCGCTCTAGGTGG - Intronic
927882934 2:26701411-26701433 GGAGAAGGGCTTGCCCCATGAGG + Intronic
932455797 2:71849181-71849203 GGGGCAGGCGTCTCCCCAGGGGG + Intergenic
932498412 2:72159279-72159301 GAGCAAGGCCTCGGCCCAGATGG + Intergenic
934640389 2:96024147-96024169 GGGGAAGGCCTAGGACCAAGTGG + Intronic
934793262 2:97081269-97081291 GGGGAAGGCCTAGGACCAAGTGG - Intergenic
935696816 2:105777369-105777391 GGGGCAGTCCTCACACCAGGAGG + Intronic
938374780 2:130798168-130798190 GGCAAAGGCCTCGGCCCAGCGGG - Intergenic
938787161 2:134640641-134640663 GGGAAAAGACACGCCCCAGGGGG + Intronic
941019078 2:160388875-160388897 GTGGAAGGCCTCCCCCCAGGGGG - Intronic
942051926 2:172147979-172148001 AGGGAGGGCCTCTGCCCAGGTGG + Intergenic
946015156 2:216598304-216598326 GGAGAATGGCTTGCCCCAGGAGG + Intergenic
946195990 2:218033377-218033399 GGGGAAGTCCTTGCTCCAGTGGG + Intergenic
946237506 2:218333034-218333056 AGGGAAGGCCTCGTCCCCAGAGG - Intronic
946329429 2:219001237-219001259 GGGGAGGGCCTAGCCCCTGCGGG + Intergenic
948426194 2:237887839-237887861 GAGGATCGCCTCGGCCCAGGAGG + Intronic
1169214940 20:3787720-3787742 GGGGAAGGCTGTGACCCAGGGGG + Intronic
1170562726 20:17570441-17570463 GGCGGCGGCCTCGCCCCAGCTGG - Intronic
1172340174 20:34151353-34151375 GAGGATGGCTTCGGCCCAGGAGG - Intergenic
1175217938 20:57401256-57401278 GGGGAACCACACGCCCCAGGGGG - Intronic
1175890125 20:62312313-62312335 AGGGATGGCCTCCCCGCAGGTGG - Exonic
1175916474 20:62428281-62428303 GGGGCTGGCCTGGCCCCGGGTGG + Intergenic
1176123887 20:63466515-63466537 GTGGAAGGCCTCACCCCGGACGG - Intronic
1178872178 21:36385734-36385756 GGGGAGGGGCCCGCCCCGGGAGG - Intronic
1179419207 21:41222475-41222497 GGGAAAGGCCCTGCCCCTGGGGG + Intronic
1179960591 21:44765229-44765251 GAGGAAGGCCAAGCCCCAGCAGG + Intergenic
1180009966 21:45042981-45043003 GGGGAAGGCCCCGCTCCAGGTGG + Intergenic
1180142557 21:45901150-45901172 GGGGCAGGCCTGGTCCCAGCTGG + Intronic
1180791261 22:18576956-18576978 GGGGAATGCCTCTCCCTGGGGGG - Intergenic
1180867769 22:19129222-19129244 GAGGAAGGCCTGTTCCCAGGTGG - Intergenic
1180877102 22:19179620-19179642 GAGGAAGGCCTGGCTCCAGCAGG + Exonic
1181028814 22:20140357-20140379 GGGGCAGGCGTAGCCCCACGTGG - Intronic
1181230477 22:21418358-21418380 GGGGAATGCCTCTCCCTGGGGGG + Intronic
1181248173 22:21516511-21516533 GGGGAATGCCTCTCCCTGGGGGG - Intergenic
1182528849 22:30939938-30939960 GGGTAAGGTCCCGGCCCAGGCGG - Exonic
1182546751 22:31081161-31081183 GAGGAAGGCCCCGCCCCTCGCGG - Intronic
1183406532 22:37633058-37633080 GGGGAAGACCCCACCCCAGCTGG - Exonic
1184485638 22:44777178-44777200 GGGGAAGGCCTGGGCCCAGCGGG - Intronic
1185380030 22:50504011-50504033 GGGTAAGGCCGGGCACCAGGGGG - Intronic
953412205 3:42696948-42696970 GGGGAAGGTGTGGTCCCAGGGGG + Intronic
953802033 3:46031655-46031677 GGGGAAGGCCTGAAGCCAGGTGG + Intergenic
954000881 3:47555906-47555928 GGGAAAAGCCTGGCCTCAGGAGG + Intergenic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
960991602 3:123315083-123315105 GGGCCAGCCCTTGCCCCAGGAGG - Intronic
961448124 3:126990606-126990628 GGGGAAGGCCTCGCCCTCTCTGG + Intronic
961454410 3:127017060-127017082 GGTGAAGGCCTGGACCGAGGTGG - Intronic
961464397 3:127072619-127072641 TGGGAAGGGCTCGACACAGGCGG - Intergenic
961562438 3:127740034-127740056 GGGGAAGCCCTGGCCTCAGCAGG + Intronic
961618535 3:128204710-128204732 GGGGAAGGCGGCATCCCAGGAGG - Intronic
962842893 3:139251811-139251833 GGGGCAGGCCTGGGCCCAGCTGG - Intronic
962848177 3:139288878-139288900 GGGGAAGGAATAGCCCCTGGAGG + Intronic
963065713 3:141262084-141262106 GGGGAAGGCTTGGCTCTAGGAGG + Intronic
964387258 3:156161230-156161252 GGGGTAGGCCTGGCCCCTGGGGG + Intronic
966152164 3:176877102-176877124 GGGGCAGGGCTCCCCCCAGAGGG + Intergenic
967040688 3:185689478-185689500 GAGCAAGGCCACGCCCCTGGGGG - Exonic
968516593 4:1018119-1018141 GGGGAAGGGCAGGCCGCAGGGGG + Intronic
968726197 4:2248899-2248921 GGTGCAGGCCTGGCACCAGGAGG - Exonic
968850653 4:3075245-3075267 GGGGAAGGCCTCGCCCCAGGAGG - Intronic
969627828 4:8316653-8316675 GTGGGAGGCCTCATCCCAGGCGG - Intergenic
972650517 4:41013552-41013574 GGGGAAGGCGTAGCCTCAGCTGG - Intronic
975347718 4:73312528-73312550 GGGGATGGCATGGACCCAGGAGG + Intergenic
980607588 4:135112207-135112229 GGGCAAGGCCTCGCCTCACCCGG - Intergenic
980800103 4:137735898-137735920 GGGGAATGCCCTGCCCCAGTGGG - Intergenic
980975627 4:139607467-139607489 GGAGAAGTCCTGGTCCCAGGAGG + Intergenic
983222827 4:165059116-165059138 GGTGAAGGTCTCGACCAAGGTGG - Intergenic
985475674 5:77675-77697 GGGGAAGGCAGAGCCACAGGCGG - Intergenic
985681420 5:1257837-1257859 GCCGAAGCCCTCGCCCCATGAGG - Intronic
985690864 5:1311550-1311572 GGGGCAGGGCTCCCCACAGGCGG + Intergenic
985748269 5:1660044-1660066 GCTGAAGCCCTCGCCCCAGCAGG - Intergenic
985806709 5:2050111-2050133 GGGGAAGGACTGAGCCCAGGAGG - Intergenic
991338083 5:65573159-65573181 AGGGAGGGCCTCACTCCAGGTGG - Intronic
997637846 5:135427804-135427826 AGAGATGGCCTAGCCCCAGGTGG + Intergenic
1001576809 5:172770229-172770251 GGGGAAGGCTGAGCCCCATGGGG + Exonic
1005575193 6:27183675-27183697 GGGGATGGCCTCTCTCCAGTGGG - Intergenic
1005989869 6:30896149-30896171 TGGGAGGGCTTGGCCCCAGGGGG + Intronic
1006355342 6:33553232-33553254 GGGGAAGGCTTGAGCCCAGGAGG - Intergenic
1006362221 6:33593038-33593060 GAGCCAGGCCCCGCCCCAGGTGG + Intergenic
1006458510 6:34145017-34145039 GCCGCAGCCCTCGCCCCAGGAGG + Intronic
1006579228 6:35067084-35067106 GGGAAAGCCCTCGCCCCAGGTGG + Intronic
1007172306 6:39872365-39872387 CGGGAAGGCATCGGCCTAGGAGG + Intronic
1007381156 6:41491178-41491200 GGGGAAGGCTACGCCACAGTGGG + Intergenic
1010334890 6:74669017-74669039 GGGGGAAGCCTCACCTCAGGAGG - Intergenic
1011261702 6:85476734-85476756 GGGGATGGCCTAACTCCAGGGGG - Intronic
1013307096 6:108859310-108859332 GGAGAAGCCGTCTCCCCAGGAGG - Intronic
1015114237 6:129629462-129629484 GGGGCAGGCGTCTCCTCAGGTGG + Exonic
1018318911 6:162585790-162585812 GGAGATGGCTTCGACCCAGGAGG - Intronic
1019277137 7:181767-181789 GGAGAGGGCCTCGCCCCATGGGG + Intergenic
1019474080 7:1235759-1235781 GGGGAGGTCCTCGGCCCCGGCGG + Intronic
1020107129 7:5427369-5427391 AGGGAAGGCCTCGGCTCCGGTGG - Intergenic
1020281622 7:6653059-6653081 GCGGAAGGCCTGGCCGCAGTCGG - Exonic
1022551988 7:31249744-31249766 TGGGAAGCCCTATCCCCAGGTGG + Intergenic
1025790588 7:64683877-64683899 AGGGAAGGCCTCGACCCATCTGG - Intronic
1026460478 7:70610523-70610545 GGGGAAAGCCTGAGCCCAGGAGG - Intronic
1026805783 7:73429142-73429164 AGGGACGGCTTCTCCCCAGGGGG + Intergenic
1032273064 7:130429189-130429211 TGGGCAGGCCAGGCCCCAGGTGG + Intronic
1034200848 7:149282108-149282130 GCGGAAGGCCTTGCCGCAGTAGG - Exonic
1034343614 7:150372626-150372648 GCGGAAGGCCTTGCCGCAGTCGG - Exonic
1034421983 7:150995359-150995381 GGGTAAGGCCTGGCCTCAGATGG + Intronic
1035202668 7:157277240-157277262 GGGGAAGGACAGGCACCAGGAGG - Intergenic
1036651514 8:10646969-10646991 GAAGAAAGCCTCGCCCGAGGCGG + Intronic
1037589879 8:20303701-20303723 GGGGATCTCCTCGCCCCTGGAGG - Intronic
1037778117 8:21849067-21849089 GGGGAAATCCTCACCCCAGAAGG + Intergenic
1038288881 8:26230839-26230861 GGGGAAGGACCTGCCCCATGAGG - Intergenic
1039081328 8:33737055-33737077 GGGGAATTCCTGTCCCCAGGAGG + Intergenic
1044973928 8:97644951-97644973 GGGGGAGGCCGCGCCCCAGCCGG + Intronic
1047248817 8:123166532-123166554 AAGGAAGGCCTCGCCCCTGCAGG + Intergenic
1048974145 8:139661848-139661870 TGGTGAGGCCTAGCCCCAGGAGG + Intronic
1049006221 8:139857315-139857337 GGGGAAGGCCTGTCCCATGGAGG + Intronic
1049442857 8:142617164-142617186 GGAGAGGCCCCCGCCCCAGGTGG - Intergenic
1049774245 8:144397275-144397297 GGAGGAGGCCACGCGCCAGGGGG - Exonic
1055021591 9:71675720-71675742 GGGCAAGGCCATGCCCCAGTGGG + Intergenic
1057180227 9:93025878-93025900 GGGCGTGGCCTCGTCCCAGGAGG - Intronic
1057221532 9:93260209-93260231 TGGGAAGGCCTCCCACCAGCAGG - Intronic
1059364483 9:113775349-113775371 GGGGAAGGCCTCTCTGCAGTAGG + Intergenic
1059391258 9:114001032-114001054 GAGCAAGGCCTGGGCCCAGGTGG + Intronic
1060414226 9:123419360-123419382 GGAGGAGGCCTGGCCCCAGAGGG + Intronic
1060941662 9:127546092-127546114 GGCCAAGGCCACGCCCAAGGAGG + Intronic
1061897322 9:133655204-133655226 GGGGAGGGCAGCTCCCCAGGTGG + Intronic
1062141084 9:134959513-134959535 GAGGAAGACCTGGCTCCAGGTGG + Intergenic
1062199268 9:135292876-135292898 GGGGAAGGCCTCCACCCAGCCGG - Intergenic
1062279280 9:135744760-135744782 GACCAAGGCCTCACCCCAGGGGG + Intronic
1062680521 9:137776797-137776819 GGAGAAGGGCTCGGCCCTGGAGG + Exonic
1185856757 X:3543315-3543337 GGGGATTGGCTCACCCCAGGGGG + Intergenic
1185894083 X:3843231-3843253 GGGGCAGGGCCCTCCCCAGGAGG + Intronic
1185899201 X:3881655-3881677 GGGGCAGGGCCCTCCCCAGGAGG + Intergenic
1185904318 X:3920084-3920106 GGGGCAGGGCCCTCCCCAGGAGG + Intergenic
1186033413 X:5394009-5394031 GGGGATGGCCTAAGCCCAGGAGG - Intergenic
1190228067 X:48560870-48560892 GGCGCAGGACGCGCCCCAGGTGG - Exonic
1192452629 X:71253457-71253479 GGGGAACGCCTCTCCCCACTGGG - Intronic
1196895798 X:120334397-120334419 AGGGAAGGCATGTCCCCAGGGGG - Intergenic
1196898652 X:120362029-120362051 GGGGAAGGGCTCATGCCAGGAGG + Intergenic
1197542926 X:127788962-127788984 GGGGAAGGCATCGCCTCACCTGG + Intergenic
1198187909 X:134272246-134272268 GGGGAGCGCCTCGGCCCAGGAGG - Intergenic
1200047088 X:153408920-153408942 GGGGAAGGCCAGGCCAAAGGGGG - Intergenic
1200807419 Y:7446807-7446829 GGGGACTGGCTCACCCCAGGGGG - Intergenic