ID: 968852966

View in Genome Browser
Species Human (GRCh38)
Location 4:3095498-3095520
Sequence CATCAGAGGGAGACTGTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 8, 3: 104, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968852962_968852966 -8 Left 968852962 4:3095483-3095505 CCAGCCTTGGCTCGGCATCAGAG 0: 36
1: 231
2: 618
3: 475
4: 409
Right 968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG 0: 1
1: 1
2: 8
3: 104
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968852966 Original CRISPR CATCAGAGGGAGACTGTGCG AGG Intronic
901028453 1:6291872-6291894 AAACAGAGCGAGGCTGTGCGGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910050620 1:82969832-82969854 TTTCAGAGGGAAACTGTGCTTGG + Intergenic
910777688 1:90892511-90892533 CATCAGAGGGAGACGTGGAGAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
919149592 1:193678861-193678883 AATGAGAGGGAGAGTGGGCGGGG - Intergenic
919667308 1:200304334-200304356 CCTCAGAGAGAGAATGTGCCAGG - Intergenic
919812049 1:201414850-201414872 GATAAGAGGAAGACTGTCCGGGG - Intronic
920962789 1:210679236-210679258 CAACAGAGGGAGGCTGTCTGGGG + Exonic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062788842 10:288376-288398 CATCAGGGGCAGACTATGAGGGG + Exonic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1067533654 10:47092612-47092634 CATCAGAGGGCCACTGAGGGAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1072185361 10:93032695-93032717 CAACAAAGGGGGACTGTGAGAGG - Intronic
1072528732 10:96298186-96298208 CATGAGAGGGAGCCTGTCGGGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073401292 10:103259784-103259806 CATCAGAGGGACCCTGGGCCTGG - Intergenic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1081371388 11:42308599-42308621 CTTCAGAGGGAAATTGTGAGAGG - Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1084111949 11:67020012-67020034 CATCACAGAGATGCTGTGCGTGG - Intronic
1084702737 11:70798148-70798170 CATCAGAGAGAGACTTTTGGGGG - Intronic
1084779585 11:71399614-71399636 CCTCAGAGTGTGACTGTGCTTGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092504975 12:9089448-9089470 AATCAAAGGGAGGCTGTGCATGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093297958 12:17415441-17415463 CCTCACAGGGAGAATGGGCGAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094432834 12:30388811-30388833 CACCAGAGAGAGAGTGTGTGTGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1103567970 12:121826622-121826644 CAGCAGAGGGAGGTTGTGAGAGG + Intronic
1103767363 12:123290181-123290203 CGCCAGAGGGAGACTGAGCAAGG + Exonic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1104792255 12:131490990-131491012 CATCAGTGGGAGGCTGTGATTGG - Intergenic
1106434264 13:29709832-29709854 CATCAGAAGGAGACTGCAGGAGG + Intergenic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1109790104 13:67235401-67235423 AATTAGAGGGGGACTGTGGGGGG - Intergenic
1111337511 13:86841445-86841467 CATCAGGGGGTGACTGGGCCTGG + Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116870548 14:50065719-50065741 CTTCAGAGTGTGACTGTGTGGGG - Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119917310 14:78413887-78413909 CATGAGAGGGACCCTGTGGGAGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123689440 15:22824447-22824469 CATCAGAGAGAGATGGTGCCAGG - Exonic
1125758296 15:42080913-42080935 CACCAGAGGGACACTTTGTGTGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126163580 15:45635145-45635167 CAGCGGAGGGAGACTGGGCGGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127516269 15:59696279-59696301 ATTCAGAGGAAGACTGTGTGAGG - Intergenic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1130360959 15:83185510-83185532 CATCAGCTAGAGACTGTGTGAGG + Intronic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1131662969 15:94538502-94538524 CATCAGAGGTAGGCTGGGTGTGG + Intergenic
1132720670 16:1314127-1314149 CAGCCGAGGGAGCCTGTCCGCGG - Intronic
1132738345 16:1398470-1398492 GCTCAGAGGGAGACTGAACGTGG + Exonic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1136004330 16:27318357-27318379 TATCAGGTGGAGACTGTGCTAGG + Intronic
1136412423 16:30085127-30085149 CCTCAGACGGAGGCTGGGCGTGG + Exonic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137676792 16:50307705-50307727 CATAATAGGGAGGCTGTGCGTGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140045304 16:71436699-71436721 CAACAGTGGGTGACTGTGGGAGG + Intergenic
1140058943 16:71550516-71550538 CATCAGAGGGACTATGTGCATGG + Intronic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG + Intronic
1142140983 16:88472788-88472810 CATCAGGGAGAGCCTGTGCCGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145005815 17:19337147-19337169 CAACAGAGGGAGGGAGTGCGTGG + Intergenic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1145936602 17:28717980-28718002 CAAAAGAGGGAGCCTGAGCGGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146936268 17:36814321-36814343 CATTCGAGGGAGACAGTGTGCGG + Intergenic
1150533798 17:66014195-66014217 CAGTAGAGGGAGAGTGTGAGTGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1156296597 18:35797400-35797422 CCTTAGAGGGAGACTGTGTTGGG + Intergenic
1156668843 18:39442733-39442755 CATGAGAGGGACACAGTGCGAGG + Intergenic
1157849863 18:51038235-51038257 CTACAGAGCGAGACTGTGGGGGG + Intronic
1160059746 18:75518182-75518204 CCTCAGGGTGAGACTGTGGGTGG + Intergenic
1161062598 19:2222608-2222630 GACCAGAGGGAGACCGGGCGCGG + Intronic
1161255238 19:3305176-3305198 GCTCGGAGGGAGACTGTGAGGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1165243322 19:34483507-34483529 CTGGAGAGGGAGACTGTGTGAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168407216 19:56116974-56116996 AATCAGTGGGAGACAGTGCGAGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925572065 2:5323070-5323092 CATGAGAGGGAAAATGTGCACGG + Intergenic
927637773 2:24828556-24828578 CATCACGGGGAGGCTGTGAGTGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928378615 2:30799464-30799486 CCTCAGAGGAAGACTATGCAGGG + Intronic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929184714 2:39081498-39081520 CAACAGAGTGAGACTGTCCTCGG + Intronic
929584926 2:43107541-43107563 GATCTGAGGGTGTCTGTGCGAGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930565586 2:53015286-53015308 CAGAAGATGGAGACTGTGTGAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
937911379 2:127077243-127077265 GATCAGAAGCAGACTCTGCGTGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
940621584 2:156120513-156120535 CATGAGAGGGACCCTGTGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942950317 2:181713769-181713791 CATTAGAGGGACCCTGTGGGAGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944809394 2:203312825-203312847 TCTCAGAGGGACACTGTGCTTGG - Intergenic
945110817 2:206357710-206357732 GTTCAGAGGGAGACTGGGAGAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
948721850 2:239905687-239905709 CATCAGAGGGAGAGCTTCCGAGG + Intronic
948861620 2:240755315-240755337 CAGCAGAGGCAGACAGAGCGAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1175478079 20:59291070-59291092 CATCAAAGGGAGGCTGTCCTGGG - Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182078853 22:27514740-27514762 CATCAGAAGGTGACTGAGTGAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184463170 22:44651742-44651764 CATCAGAAGGAGTCTGCTCGTGG - Intergenic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
958058914 3:88452055-88452077 CAACAGTGGGATACTGTGAGAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
960499545 3:118419650-118419672 CATGAGAGGGAACCTGTGGGAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967045551 3:185733464-185733486 AATCAGAGCCAGACTGGGCGCGG + Intronic
967423970 3:189304889-189304911 AAACAGAGGGAGGCTGTGAGTGG - Intronic
967684246 3:192400821-192400843 CATAAGAGGTAGACTATGAGTGG - Intronic
967908170 3:194519116-194519138 CAAGAGAGGGAGGTTGTGCGGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969805228 4:9602597-9602619 CTTCAGAGGGAGGCAGTACGGGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970641884 4:18075975-18075997 CACTAGAGGGAGACTGAGCGTGG + Intergenic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976376251 4:84348898-84348920 TATCAGAAGGAGACTGGGCCAGG + Intergenic
976665279 4:87583878-87583900 CACCCAAGGAAGACTGTGCGTGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981236214 4:142418854-142418876 CATCAGGTGGAGACTGAGCAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985245789 4:187978589-187978611 CACCTGAGGGAGGCTGTGAGTGG - Intergenic
986304105 5:6502821-6502843 CATCAGAGTGTGGCTGTGGGGGG - Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
987586570 5:19863788-19863810 CAACATAGGGAGGCTGTGAGAGG + Intronic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991435695 5:66596049-66596071 CGTCAGAGGGAGACGGCGAGCGG - Intergenic
992800651 5:80292763-80292785 CACCAGAGTGAGGCTGGGCGTGG - Intergenic
993938369 5:94030091-94030113 CATCAGAGGGACCCGGTGAGAGG - Intronic
994050627 5:95358458-95358480 GAGCAGAGAGAGACTGTGAGAGG + Intergenic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
1000040278 5:157480120-157480142 CATTAGAGGGAGAATGAGAGGGG + Exonic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000698475 5:164418883-164418905 CATCAGAGAAAGACTGTTCTTGG - Intergenic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1006674932 6:35755907-35755929 CATCAGAGGGAAACTCTGATTGG - Intergenic
1006829047 6:36957939-36957961 CAACAGTGGGAGACTGGGAGTGG - Intronic
1007243682 6:40444797-40444819 ACTGAGAGGGAGACTGTGCGGGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009622390 6:66094609-66094631 AATCAAGGGGGGACTGTGCGTGG + Intergenic
1010239580 6:73602482-73602504 CATTAGAGGAAGGCTGGGCGCGG + Intronic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019919076 7:4151287-4151309 CTGCAGAGGGTGACTGTGCCAGG - Intronic
1020478033 7:8621900-8621922 CTTCAGAGGCAGACTGTCCTTGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022549969 7:31229001-31229023 CAACAGAGGTAGACTGGGCGGGG + Intergenic
1023301407 7:38776044-38776066 CTTCAAAGGGAGACTGGGTGTGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1030465998 7:109904884-109904906 CTTCAGAGGAATACTGTGCAAGG + Intergenic
1031772768 7:125865959-125865981 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033800200 7:144892243-144892265 CATCTGTGGGAGACTCTGCTTGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036003869 8:4639284-4639306 CATCAGAGGCAGACTGTTACAGG - Intronic
1036434457 8:8720525-8720547 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1037439778 8:18903730-18903752 CATCCTAGGGAAACTGTGCCTGG - Intronic
1038502206 8:28054607-28054629 GCTCAGAGGGAGAGTGTGAGAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038883929 8:31641829-31641851 CATCACAGGCAGACTCTGCTTGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041290028 8:56299940-56299962 CATCAGTGGGTGACTCTGAGAGG + Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046391341 8:113576840-113576862 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048775616 8:137942824-137942846 CATCAAAGAGAGAATGTGCTAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053200661 9:36149585-36149607 CTCCCGAGGGAGGCTGTGCGAGG - Intronic
1057479686 9:95434740-95434762 CATGAGAAGCAGACTGTGAGAGG - Intergenic
1057718443 9:97514016-97514038 TTTCAGAGGGACACTGTGCTTGG + Intronic
1061467047 9:130789195-130789217 CATCAGAGAGAAAATGTACGGGG + Intronic
1186453305 X:9691143-9691165 CATCAGAGGTAGGCCGGGCGTGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189798060 X:44664795-44664817 CATAAGAGGGACCCTGTGGGAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191005188 X:55703398-55703420 CTTCAGATGGAGACTCTGAGTGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192584530 X:72308739-72308761 TATCAGAGGGAGACTAGGCAGGG - Intergenic
1195619605 X:106939751-106939773 CATCAGATGGGGGCTGTGAGTGG - Intronic
1200120110 X:153786159-153786181 CTGCAGGGGGAGACTGGGCGGGG + Intronic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1201629559 Y:16055099-16055121 CATGAGAGGGACACAGTGAGAGG - Intergenic