ID: 968853224

View in Genome Browser
Species Human (GRCh38)
Location 4:3098492-3098514
Sequence GCATCCAAACCAGTAACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968853224_968853225 12 Left 968853224 4:3098492-3098514 CCTTGTGTTACTGGTTTGGATGC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 968853225 4:3098527-3098549 TGAAGTCAGTTTCATGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968853224 Original CRISPR GCATCCAAACCAGTAACACA AGG (reversed) Intronic
900084244 1:881298-881320 ACATCAAAAACAGTACCACACGG - Intergenic
905494972 1:38377774-38377796 GCATCCAAGCCAGCAAGAGATGG + Intergenic
908390531 1:63679516-63679538 GCATCCAATCCTGTCACATAAGG + Intergenic
912529557 1:110310471-110310493 GCATCCAAACCAGCAAACCAGGG + Intergenic
916262049 1:162851812-162851834 ACATTCAAATTAGTAACACATGG - Intronic
917768919 1:178254644-178254666 GCAACCAAGCCAAGAACACAAGG + Intronic
921064238 1:211611507-211611529 GCAGTCAAACCATTAACCCATGG + Intergenic
921919889 1:220655898-220655920 GCTTCCACACCAGCCACACAGGG + Intronic
922905138 1:229168503-229168525 GCAGCCCCACCAGAAACACATGG - Intergenic
922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG + Intergenic
1062885781 10:1015285-1015307 GCGTCTGAACCATTAACACATGG - Intronic
1063006774 10:1979196-1979218 GCATACAATCCAGAAACACAGGG + Intergenic
1065989755 10:30996872-30996894 GAATACAAATCAGTAACAGAAGG + Intronic
1071930988 10:90470116-90470138 CACTCCAAACTAGTAACACATGG + Intergenic
1074564529 10:114565251-114565273 GCATCCACACATGTAGCACATGG - Intronic
1076254915 10:129014696-129014718 ACATCCAAAACAGGAATACATGG + Intergenic
1080957053 11:37110445-37110467 ACATGAAAAACAGTAACACAGGG - Intergenic
1088305002 11:108398363-108398385 TCATCCAAGCCAGAAACAGAGGG - Intronic
1094557936 12:31521670-31521692 CCATCCAAACCATTAAACCAAGG + Intronic
1095736419 12:45561544-45561566 GCATCAAAACCAGCTCCACATGG - Intergenic
1103826515 12:123743352-123743374 GTTGCCAAAGCAGTAACACAAGG + Intronic
1106733068 13:32561951-32561973 GCAACCAAAGCAGTTGCACAGGG - Intergenic
1106916026 13:34515273-34515295 GGAACCACACCACTAACACATGG - Intergenic
1109217424 13:59605496-59605518 TCAACCAAATCTGTAACACAGGG + Intergenic
1112043400 13:95571143-95571165 GCATCCACCACAGTGACACATGG + Intronic
1114780835 14:25536576-25536598 GCATCCAATCCAATACCACAGGG + Intergenic
1118359902 14:65047027-65047049 TCATACAAACCAGTAAGAAATGG + Intronic
1119173914 14:72555225-72555247 GCATCAGCATCAGTAACACAGGG + Intronic
1124524033 15:30431719-30431741 GCATCTGTGCCAGTAACACATGG + Intergenic
1124534633 15:30534497-30534519 GCATCTGTGCCAGTAACACATGG - Intergenic
1124764016 15:32473102-32473124 GCATCTGTGCCAGTAACACATGG + Intergenic
1124774612 15:32575946-32575968 GCATCTGTGCCAGTAACACACGG - Intergenic
1126334854 15:47575939-47575961 CCAGCCAAACCAGTAAGACTGGG - Intronic
1128333672 15:66772690-66772712 GTTTCCTAACCTGTAACACAGGG - Intronic
1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG + Intergenic
1134794399 16:17021572-17021594 ACATCCAAACCATTAATAAAGGG - Intergenic
1139381868 16:66537520-66537542 GCCTCCAAACCAGTGAGACAGGG - Intronic
1141368953 16:83469688-83469710 GCATCCACAGCACTAGCACAGGG + Intronic
1148406080 17:47417555-47417577 GCTTCCAAACCAGTGCCAGATGG - Intronic
1152118363 17:78402817-78402839 GCATCCAACTCAGGAAGACAGGG - Intronic
1160419194 18:78732522-78732544 GCATCAAAGCCTGGAACACAAGG + Intergenic
1161369204 19:3900502-3900524 GCATCAAAACAAGAAAGACAGGG - Intronic
1165157234 19:33796116-33796138 GCTCCCAAATAAGTAACACAGGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
928154555 2:28865061-28865083 GCTTCCAAAACAGTATCACCTGG + Exonic
933061757 2:77746619-77746641 GCATCCATACAATTAACATAAGG + Intergenic
933376334 2:81484015-81484037 GAAACCAAACCAATAACAGAAGG - Intergenic
936391063 2:112074159-112074181 GTATACAAACCAGTGACACTAGG - Intronic
945823847 2:214696954-214696976 GCATGCCATCCAGGAACACAAGG + Intergenic
1172204091 20:33149927-33149949 GCATTCAACCCATTACCACAGGG - Intergenic
1178713893 21:34945979-34946001 GCATCCAAACCTGGAAAACCAGG - Intronic
1179220273 21:39400637-39400659 GTGTTCAAACCAGTCACACATGG - Intronic
951800950 3:26595664-26595686 GCATCCAAATCTTTATCACAGGG - Intergenic
952340405 3:32440842-32440864 GGGAACAAACCAGTAACACACGG - Intronic
952407332 3:33016125-33016147 CCATCCAAACCCATAAAACAGGG + Intronic
952460590 3:33521417-33521439 GCACCCTATCTAGTAACACATGG - Intronic
953693542 3:45140028-45140050 GCCTCCAGATCAGTAACAGAAGG + Intronic
959202371 3:103263729-103263751 GCATCTAAAACAGTACTACAAGG + Intergenic
961175898 3:124834700-124834722 GCAAGCAAACCAGGAATACAGGG + Intronic
961618916 3:128207671-128207693 GCATTCAAAGCAGGAACACAGGG + Intronic
968853224 4:3098492-3098514 GCATCCAAACCAGTAACACAAGG - Intronic
969074322 4:4565414-4565436 GAATCCAAAGCTGTAACAGAAGG - Intergenic
972572333 4:40321648-40321670 TCATCAAAACCAGGAACCCATGG + Intergenic
974138484 4:57850931-57850953 GCTTCCAAATCTGTAACAAAAGG + Intergenic
976171140 4:82305700-82305722 GCATTCAAACCTGTGAGACAGGG + Intergenic
982866995 4:160525718-160525740 GTATCCAAACTAGCATCACAAGG + Intergenic
983421049 4:167517376-167517398 GGCTACAAACCTGTAACACATGG + Intergenic
987162116 5:15155351-15155373 GGAGCAAAACCAGTAACAAAGGG + Intergenic
991361258 5:65822965-65822987 GTTTCCAGGCCAGTAACACATGG - Exonic
994027890 5:95105899-95105921 GCCTCGAAACCTATAACACATGG - Intronic
1000046764 5:157528277-157528299 GCATGCAAAACAGAAACACACGG + Intronic
1000752442 5:165113616-165113638 GCTTCCAAACCAGTGGCAGACGG + Intergenic
1006053297 6:31360392-31360414 GCATCCAAATCAGTGCAACATGG - Intergenic
1008712001 6:54238564-54238586 GCAAACAAACGAGAAACACATGG + Intronic
1009221966 6:60994202-60994224 GCATTAAAAACAGTATCACAGGG - Intergenic
1009272402 6:61630504-61630526 GCAACCAAACCAGACATACATGG + Intergenic
1010128211 6:72460018-72460040 GAAGCCAAACCTGTAACACAAGG + Intergenic
1011928017 6:92672543-92672565 GCAACCAAAGCAGTTATACATGG - Intergenic
1012684159 6:102222558-102222580 GCATCCATTCCAGCCACACAGGG + Intergenic
1015991631 6:138950586-138950608 GCATACAAAACGGTAACATAAGG - Intronic
1017142705 6:151206267-151206289 GCAAAGAAACCAGTAACAAAAGG - Intergenic
1017473694 6:154766530-154766552 GCTTCCAAACCAGTGCCAGACGG - Intronic
1022345810 7:29513347-29513369 CTATCCAAAGCAGGAACACAAGG - Exonic
1023539674 7:41251814-41251836 GCCTCCAAAGCAGGAACAGAAGG + Intergenic
1025713133 7:63930242-63930264 GCATCCAAACCTGAGTCACAAGG + Intergenic
1026444311 7:70470820-70470842 CCAGCCAAACCAGTAACAAAGGG + Intronic
1026570091 7:71521812-71521834 ACATCCGAAACAGTAACAGATGG + Intronic
1028898055 7:96064096-96064118 GAATCCAAACCAGCACCACAGGG - Intronic
1029476006 7:100785028-100785050 GAATCCAAACAAGCAGCACATGG + Intronic
1031606344 7:123772438-123772460 GCATCTAGACAAGTGACACATGG + Intergenic
1033811776 7:145022059-145022081 TTATCAAAACCAGTAACACATGG + Intergenic
1034309315 7:150072667-150072689 GCTTACAAACCAGTAAGACTGGG + Intergenic
1035637838 8:1160526-1160548 GCATCCAAAGCAAAAACACGTGG - Intergenic
1037496472 8:19445849-19445871 GCCTCCAAACCAAAAACATATGG - Intronic
1041864023 8:62547951-62547973 GCATCCACATCAGTATCACCTGG - Intronic
1041938807 8:63364363-63364385 GCAACCAAACCAGCAACTCCTGG + Intergenic
1044016572 8:87053711-87053733 GGATCCATACCAGTCACGCAAGG - Intronic
1048121514 8:131586935-131586957 GCATCAAAAGTAGTAACTCAAGG + Intergenic
1048366140 8:133740303-133740325 GCAAACAAACAACTAACACAAGG - Intergenic
1053455980 9:38233420-38233442 GGATCCTATCCAGTGACACAAGG - Intergenic
1061365293 9:130169608-130169630 GCATAGAAACCAGAAACACGGGG - Intergenic
1061596001 9:131629396-131629418 GCAACCAAACCAGAACCCCAGGG - Intronic
1190955743 X:55191537-55191559 GCATATAAAACAATAACACAAGG - Intronic
1196386188 X:115154743-115154765 GCATTCCCACAAGTAACACATGG - Intronic