ID: 968853533

View in Genome Browser
Species Human (GRCh38)
Location 4:3101417-3101439
Sequence CCTCAGATGCTGTAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968853527_968853533 30 Left 968853527 4:3101364-3101386 CCTTATGCTTAAGTTTGGTGCAG 0: 1
1: 0
2: 2
3: 5
4: 66
Right 968853533 4:3101417-3101439 CCTCAGATGCTGTAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968853533 Original CRISPR CCTCAGATGCTGTAGTTGTC AGG Intronic
No off target data available for this crispr