ID: 968864490

View in Genome Browser
Species Human (GRCh38)
Location 4:3199108-3199130
Sequence CAGCTCCTGGAGAAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 422}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968864490_968864495 15 Left 968864490 4:3199108-3199130 CCTGACTCCTTCTCCAGGAGCTG 0: 1
1: 0
2: 5
3: 31
4: 422
Right 968864495 4:3199146-3199168 AGCTCTTGGCTTGGAGCTCCTGG 0: 1
1: 0
2: 1
3: 29
4: 251
968864490_968864497 19 Left 968864490 4:3199108-3199130 CCTGACTCCTTCTCCAGGAGCTG 0: 1
1: 0
2: 5
3: 31
4: 422
Right 968864497 4:3199150-3199172 CTTGGCTTGGAGCTCCTGGAGGG 0: 1
1: 1
2: 6
3: 43
4: 358
968864490_968864494 6 Left 968864490 4:3199108-3199130 CCTGACTCCTTCTCCAGGAGCTG 0: 1
1: 0
2: 5
3: 31
4: 422
Right 968864494 4:3199137-3199159 GACTTTCGCAGCTCTTGGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 78
968864490_968864496 18 Left 968864490 4:3199108-3199130 CCTGACTCCTTCTCCAGGAGCTG 0: 1
1: 0
2: 5
3: 31
4: 422
Right 968864496 4:3199149-3199171 TCTTGGCTTGGAGCTCCTGGAGG No data
968864490_968864493 1 Left 968864490 4:3199108-3199130 CCTGACTCCTTCTCCAGGAGCTG 0: 1
1: 0
2: 5
3: 31
4: 422
Right 968864493 4:3199132-3199154 GTTCAGACTTTCGCAGCTCTTGG 0: 1
1: 0
2: 0
3: 4
4: 111
968864490_968864498 24 Left 968864490 4:3199108-3199130 CCTGACTCCTTCTCCAGGAGCTG 0: 1
1: 0
2: 5
3: 31
4: 422
Right 968864498 4:3199155-3199177 CTTGGAGCTCCTGGAGGGCTTGG 0: 1
1: 0
2: 7
3: 82
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968864490 Original CRISPR CAGCTCCTGGAGAAGGAGTC AGG (reversed) Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
902340946 1:15783364-15783386 CAGATCCTGGAGACCCAGTCTGG + Intronic
902407306 1:16191788-16191810 CAGGACCTGGAGATGGCGTCTGG - Intergenic
902510739 1:16965775-16965797 CAGGTCCTGGAGATGGTGGCTGG - Exonic
902618647 1:17637906-17637928 CAGCTCCTGGAAGAGGCGTGGGG - Exonic
902776291 1:18676862-18676884 CAGCCCCCTGAGAAGGGGTCTGG - Intronic
903029382 1:20451986-20452008 CAGCTCCAGGAGAAGAACCCAGG + Intergenic
903225513 1:21892382-21892404 CCGCTCCTGGGGAAGGGGACTGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
904039772 1:27577100-27577122 GAGCTACTGGAGAGGGAGTGAGG - Intronic
904430863 1:30463178-30463200 CAGCTCCAGGACCAGGAGCCAGG - Intergenic
904485065 1:30819203-30819225 CAGCTCCGTGGGCAGGAGTCAGG + Intergenic
904684117 1:32248456-32248478 CAGCTCCTGGTGCAGGTGACAGG - Exonic
904887551 1:33752448-33752470 CAGCTCCTGGTGAGGGTCTCAGG - Intronic
905149697 1:35917975-35917997 CAGCTCCTAGAGAAGGGGAAGGG + Intronic
905973139 1:42155865-42155887 GAGCTTCTGGAGAAGAAGTGTGG + Intergenic
906016898 1:42590191-42590213 CAGCTTCTGGTGAGGGACTCAGG - Intronic
906728378 1:48060496-48060518 AAAGTCCTGGGGAAGGAGTCAGG - Intergenic
906748329 1:48237161-48237183 CAGTTTGTTGAGAAGGAGTCAGG + Intronic
907380356 1:54082047-54082069 CAGGTTCTGGAGGTGGAGTCAGG + Intronic
907542872 1:55232656-55232678 CAGATCCTGGAGAGGGACTCTGG + Intergenic
907547670 1:55276296-55276318 CTGATCCTGGAGGTGGAGTCAGG - Intergenic
907845662 1:58204212-58204234 CAGCTCTTGGAGAATGAGATTGG + Intronic
908047825 1:60190555-60190577 CTGCTCCTGGTGAAGGCCTCAGG - Intergenic
908991003 1:70089104-70089126 CAGCTCCTGGAGTAGGAGTTAGG - Intronic
910200021 1:84690156-84690178 CCGCTCCTGGAGGAGGAGGTGGG - Intronic
910610241 1:89133713-89133735 CAGCTCCTGGGGAAGGGGTGAGG + Intronic
913152677 1:116060886-116060908 CAGCTCCAGAAGGTGGAGTCTGG + Intronic
914906939 1:151754115-151754137 CAGATCTTGGAGAATGAGTATGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915257597 1:154646642-154646664 CAGCTTCTGGCGAAGGCTTCGGG + Intergenic
916043965 1:160984168-160984190 CAGCTACTCGAGAAGTAGACAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918060022 1:181052951-181052973 CAGCTCCTGGAGGCTGAGGCAGG + Intronic
918363715 1:183784664-183784686 CAGATACTGGAGAAACAGTCAGG + Intronic
919847187 1:201649473-201649495 CAGCTGCTGGGGAAGGTGTGGGG + Intronic
920438364 1:205962665-205962687 CAGCTCATGAAGGAGGAATCAGG - Intergenic
922212096 1:223494254-223494276 AAGGTCCAGGAGAAGGAGACAGG - Intergenic
922584727 1:226725000-226725022 CAGCCTCTAGGGAAGGAGTCTGG - Intronic
922937529 1:229433428-229433450 CAGCTCCTGGAACAGGTGTCAGG - Intronic
923227036 1:231947959-231947981 CAGATGCTGGAGAGGGAGTGGGG + Intronic
923594045 1:235346438-235346460 CAGCACGTACAGAAGGAGTCAGG - Intergenic
923628314 1:235632198-235632220 CAGCTCCTCAGGAAGGAGGCAGG - Intronic
923898955 1:238304599-238304621 CTGCTCCTGGTGAGGGACTCAGG - Intergenic
924847987 1:247791863-247791885 CTGCTCCTGGAGAAGCTCTCTGG + Intergenic
1062779666 10:190482-190504 CAACACCTGAAGGAGGAGTCTGG - Intronic
1063228108 10:4034907-4034929 CAGCACCTGGAGACCGGGTCTGG - Intergenic
1063368305 10:5504787-5504809 CCTCTCCAGGAGAGGGAGTCGGG - Intergenic
1063386518 10:5619644-5619666 CTGCTCCTGGACAAGGATGCAGG + Intergenic
1063636744 10:7788964-7788986 CAGGTCCTGGGGGAGGAGTTCGG + Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1066004284 10:31133058-31133080 CAGCTCCTGGGGAGGGAGGAAGG - Intergenic
1066180390 10:32956966-32956988 GAGCTCCTGGAGAAGGCATGGGG - Intronic
1066290854 10:34013203-34013225 CAGCTGCAGGAGCAGGGGTCTGG - Intergenic
1066531356 10:36343804-36343826 TAGCTTCTGGAGGAGGAGTTTGG - Intergenic
1067077572 10:43196914-43196936 CCGGGCCTGGACAAGGAGTCAGG + Intronic
1067773668 10:49145661-49145683 CACTTCCTAGAGAAGGAGTTGGG - Intergenic
1069062564 10:63909466-63909488 TATGTCCTGGAGAGGGAGTCGGG + Intergenic
1069837829 10:71320107-71320129 GAGCTTCTGAAGAAGGAGCCAGG - Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1071225465 10:83523675-83523697 CTGCTTCTGGAGAGGGACTCAGG + Intergenic
1071681562 10:87711146-87711168 CAGCTCATGGAGGTGGAGTTGGG - Intronic
1073125450 10:101146308-101146330 TCGCCCCTGGAGAAAGAGTCAGG - Intergenic
1073873535 10:107894639-107894661 CTGCTTCTGGTGAAGGATTCAGG + Intergenic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1075325391 10:121527822-121527844 CAGCTCCTCGGGAGGGAGCCTGG - Intronic
1075624138 10:123949647-123949669 CAACTCCTACAGAAGGAGTGGGG - Intergenic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076677253 10:132153528-132153550 CCTCTCCTGGAGAAGGTGTCAGG + Intronic
1076754278 10:132560339-132560361 CAGCTGCTGTGGAAAGAGTCTGG - Intronic
1078339477 11:10488674-10488696 AAGCTCCTGGGGGAAGAGTCGGG + Intronic
1078591689 11:12646598-12646620 CTGCTTCTGGTGAAGGATTCAGG - Intergenic
1078818625 11:14852768-14852790 CAGCGCCTGGCAAAAGAGTCTGG - Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079615120 11:22482555-22482577 CAGCTTCTGGAGAGGGCCTCAGG - Intergenic
1080818819 11:35785680-35785702 CAGCTCCTAGGGAGGGATTCAGG - Intronic
1081917720 11:46744100-46744122 CAGTTCCTGAAGAGTGAGTCTGG + Exonic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1083591910 11:63900542-63900564 CAGCTCCTGCAGGAGGATCCAGG - Exonic
1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG + Intronic
1084190289 11:67495559-67495581 CAGCTCCTCCAGAAAGAGGCTGG + Exonic
1084642618 11:70434766-70434788 CTGCTCCTGAGGAAGGGGTCCGG + Intronic
1085056154 11:73405183-73405205 CTTCTCCTGGAGGTGGAGTCAGG + Intronic
1085444395 11:76590740-76590762 GAGCTCCTGGAGAGGGGGCCTGG + Intergenic
1085644625 11:78214961-78214983 CAGCCCCTGGGGAAGGAGGTAGG - Intergenic
1087253331 11:95927906-95927928 CAGCTTCTGGAGACTGAGGCAGG + Intergenic
1087692560 11:101338622-101338644 CAGTGCCTGAAGAAGGAGCCTGG + Intergenic
1088797288 11:113274450-113274472 CAGTTCCAGGAAAGGGAGTCGGG - Intronic
1088852816 11:113719257-113719279 AAGATCCTGGACTAGGAGTCAGG - Intergenic
1089610204 11:119664655-119664677 CAGCTCCTGGAGTGGGAGGTGGG + Exonic
1090983704 11:131747331-131747353 CAGCTTCTGCAGAAAGACTCAGG - Intronic
1091347719 11:134866499-134866521 GTGCTCCTAGGGAAGGAGTCTGG + Intergenic
1091610658 12:2004677-2004699 CAGCTCTTGGAGAAAGAAACGGG - Intronic
1095852476 12:46825962-46825984 CAGCGCCTGGAGCATGAGCCGGG - Exonic
1096106465 12:48999220-48999242 GAGCTCCAGGATGAGGAGTCTGG - Exonic
1096109765 12:49021634-49021656 GAGCCCCTGGAGCAGGAGGCTGG - Exonic
1096385486 12:51192302-51192324 TGGCTCCTGGAGAAGTAGTGTGG - Intronic
1099874775 12:88391224-88391246 CAGTTCCTGGAAAAGGATTCTGG - Intergenic
1100003936 12:89871464-89871486 GAACTGGTGGAGAAGGAGTCAGG + Intergenic
1101664090 12:106793852-106793874 CAACTCCTGGAGAAGGTGGGTGG + Intronic
1102783821 12:115587736-115587758 CAGCTTCTGGTGAAGGCCTCAGG - Intergenic
1103004136 12:117408309-117408331 CAGCTCCTGGGGAAGGAGGGGGG - Intronic
1103212728 12:119178685-119178707 CAGCTCCTGGAGCAAGAGGAGGG + Exonic
1103747715 12:123137279-123137301 CAGCTCCAGGAAAAGGTGGCAGG - Intronic
1104347033 12:128009472-128009494 CAGCTCCTGGTGAGGGGATCTGG + Intergenic
1104807383 12:131598390-131598412 CAGGTGCTGGAAATGGAGTCTGG + Intergenic
1106345407 13:28872141-28872163 AGGCTCCTGGAGAAGGAGTCTGG + Intronic
1106406560 13:29479888-29479910 CAGCGGCTGGAGAAGGAGCTGGG - Intronic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1111193800 13:84845204-84845226 CAGCTCCTTGGGCAGGAGGCAGG + Intergenic
1112755317 13:102625786-102625808 GAGCTCCAGGAGAAGTAGGCAGG - Intronic
1112996918 13:105585693-105585715 CAGCCCCGGGAGATGGAGACAGG + Intergenic
1113632264 13:111896444-111896466 CAGCTCCGAGAGCAGGAGGCTGG + Intergenic
1114223122 14:20714726-20714748 CAATTCCTGTAGAAGGAGACTGG + Intergenic
1114428366 14:22639491-22639513 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1115642094 14:35341495-35341517 GAGGCCCTGGAGAAGGAGCCTGG - Intergenic
1115679395 14:35719212-35719234 CAGCTACTGGAGGCTGAGTCAGG + Intronic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1118951081 14:70437321-70437343 CAGCCCCCGAAGAGGGAGTCTGG + Intergenic
1119052452 14:71383616-71383638 CAGCTCCTGGCGAGGGCCTCTGG + Intronic
1119444727 14:74653754-74653776 CAGGTCCTGATGAAGGAGTAAGG - Intronic
1121237480 14:92403076-92403098 CAGGTCCTGCAGAAGGGGACAGG + Intronic
1121498668 14:94416088-94416110 CTGCACCTGGAGGAGGTGTCTGG - Intergenic
1121880685 14:97498029-97498051 CAGCTCCTGCAGATGGACTGGGG - Intergenic
1122037043 14:98956466-98956488 CTGCCCCTGGGGCAGGAGTCGGG + Intergenic
1122037584 14:98960168-98960190 CAGGTCCTGGGGCAGGAGTGGGG - Intergenic
1122071149 14:99206072-99206094 CTGCTCCTGGAGAGAGAATCTGG - Intronic
1202895077 14_GL000194v1_random:2130-2152 CATCTCCTGGACATGGGGTCTGG + Intergenic
1125079605 15:35657078-35657100 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1125108753 15:36005730-36005752 GAGTTCCTGGAGAGGAAGTCTGG + Intergenic
1125449857 15:39796874-39796896 CAGCACCTGGAGCAGGGGTGCGG - Intergenic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1128149615 15:65355102-65355124 CACCTCCTGGCGTTGGAGTCAGG - Intronic
1128551054 15:68598194-68598216 CAGCCCCTGGAGAAGAGGGCGGG + Intronic
1128657946 15:69476248-69476270 CAGCAACTAGAGAAGGAGCCAGG - Intergenic
1130056295 15:80528773-80528795 CTGCTCCTGGTGAAGGTCTCAGG - Intronic
1130900797 15:88205695-88205717 CAGGGCCTGGAGAACGAGTAGGG - Intronic
1131127688 15:89869077-89869099 CAGCTCATTGAGAACGGGTCAGG + Intronic
1131141242 15:89978258-89978280 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1132415161 15:101614189-101614211 CTGCTCCTGGGGAAGGAGGAAGG - Intergenic
1132884721 16:2177620-2177642 CAGCCCCTGGAGAGGGGGCCAGG + Exonic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1132966234 16:2656480-2656502 AGGCACCTGGAGAAGGATTCTGG + Intergenic
1132989633 16:2786116-2786138 CAGCTCCTGGAGGAGGAAGCAGG + Exonic
1135209860 16:20515977-20515999 CAGAGTCTGGAAAAGGAGTCTGG + Intergenic
1135678545 16:24437837-24437859 CAGCTTCTGGTGAGGGATTCAGG - Intergenic
1136590377 16:31214752-31214774 CAGCTCCTGGTGCAGGAGGCCGG - Exonic
1137758962 16:50925219-50925241 CAGCTCCTTGAGAAGGTGGTGGG - Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1139231142 16:65283578-65283600 CAGCACCTGGTGAAGGGGCCTGG + Intergenic
1141323413 16:83033744-83033766 GAGCTCCTGGTGAAGAAGGCAGG - Intronic
1142743266 17:1942555-1942577 CACCTCCTGGAGTATGAATCTGG + Intronic
1143018423 17:3904077-3904099 GAGCTCCTGGAGAAGGGGTCTGG - Intronic
1144120896 17:12151196-12151218 ACGCTCCTGTAGAAGGTGTCTGG - Intergenic
1145886339 17:28384822-28384844 CTGCTCCTGGGGGAGGAGTCGGG - Exonic
1147135918 17:38434218-38434240 CTTCTCCTGGAGGAGGAGCCAGG + Intronic
1147164827 17:38587524-38587546 CAGCTCCTGCAGATTGGGTCAGG - Intronic
1147320388 17:39642414-39642436 CAGCTCCAGGAGAGGCAGCCTGG + Intronic
1147677552 17:42218589-42218611 CAGCAACTGGAGATGGAGTTGGG + Intronic
1147688486 17:42300982-42301004 CAGCAACTGGAGATGGAGTTGGG - Intronic
1147795091 17:43036563-43036585 CTGGTCCTGGAGGAGGAGTTGGG + Intergenic
1149014339 17:51890582-51890604 CATCTCTTTGAGAAGTAGTCAGG + Intronic
1149436290 17:56636322-56636344 CAGCTCATGGTGAAAGAGCCAGG + Intergenic
1149660310 17:58331360-58331382 GGGCTCTTGGAGCAGGAGTCAGG - Intergenic
1149852913 17:60051802-60051824 CAGCTCCTGGAAACCCAGTCTGG + Intronic
1150557860 17:66269478-66269500 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1151872185 17:76843958-76843980 CAGCTCCAGGACCAGCAGTCGGG + Intergenic
1151886899 17:76928193-76928215 CGGGCCCTGCAGAAGGAGTCTGG - Intronic
1151994022 17:77597354-77597376 CAGCTCAGGGAGGAGCAGTCAGG - Intergenic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152514949 17:80817628-80817650 CAGGTCCGGGAGAAGGGGTGGGG + Intronic
1152574460 17:81133992-81134014 CAGCTCCTCCACCAGGAGTCGGG + Intronic
1154020923 18:10663419-10663441 GAGCTCCTGGAGCAGAATTCTGG - Intergenic
1156154823 18:34288944-34288966 CAGCTCCTGGTGAAGATCTCAGG + Intergenic
1156493418 18:37510359-37510381 CAGCTTCTGGGGAAGAAGGCAGG - Intronic
1157177957 18:45468187-45468209 CAGCCCCTGGAGAACCATTCTGG - Intronic
1157907509 18:51582757-51582779 CTGCTGTTGGAGAAGGAGGCTGG + Intergenic
1158378255 18:56898285-56898307 CAGCTCTTACAGAAGGATTCTGG + Intronic
1160526186 18:79539526-79539548 CAGCTGCTGGAGGAGGGGGCAGG - Intergenic
1161061329 19:2216629-2216651 CCGCGCCTGGAGAAGCTGTCTGG + Exonic
1161406760 19:4095225-4095247 CAGCTCTGGGAAAAGGAATCTGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1162136525 19:8558753-8558775 GAGCTCCTGGAGACAGAGACTGG + Intronic
1162637640 19:11982807-11982829 CAGCTTCTGGTGAAGGCCTCAGG + Intergenic
1162744327 19:12790303-12790325 CAGCCCCGGGGGAAGGAGCCCGG - Intronic
1163034067 19:14561495-14561517 CAGCCCCTGAGGTAGGAGTCTGG - Intronic
1164396992 19:27874731-27874753 CTGCTTCTGGTGAAGGACTCAGG + Intergenic
1164439159 19:28258886-28258908 AAGCTCCTGGAGCAGGGGTGTGG + Intergenic
1164809403 19:31144193-31144215 AAGATCGTGGAGAAGGAGACAGG + Intergenic
1165834147 19:38744113-38744135 CAGCTCGTGGATGAGGAGGCTGG - Exonic
1165845712 19:38816518-38816540 CACCTCCTGGGGGAGGAATCGGG + Exonic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166338684 19:42123952-42123974 CAGCTCCTTTAGTAGGAGTGGGG - Intronic
1167158933 19:47755376-47755398 CAGCTCCTGGTGCCGGAGCCGGG - Exonic
1167558035 19:50207630-50207652 CATTTTATGGAGAAGGAGTCAGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167677306 19:50895263-50895285 CAGCTCCTGGGGATGGAATCAGG + Intergenic
1167681918 19:50928800-50928822 CAGCTCAGGGAGACAGAGTCAGG - Intergenic
1168301828 19:55409113-55409135 CAGCTTCTGAAGAAGGAATAAGG + Intergenic
926306909 2:11643986-11644008 CTGCTCCTGGTGAAGGCTTCAGG + Intergenic
927521121 2:23698938-23698960 GAGCTCCTGCAGAAGGAGCTGGG - Intronic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
927841740 2:26449401-26449423 CAGCTGCTGCTGAAGGGGTCAGG + Intronic
927860284 2:26556458-26556480 GAGCTCCTGGGGAAGGGGGCTGG - Intronic
930572904 2:53109565-53109587 CCGTTCCTGGAGAAGAGGTCAGG + Intergenic
930665282 2:54095372-54095394 CAGCTCCTTGAGAACGGGCCAGG - Intronic
931205389 2:60140962-60140984 CAGCTTCTGGAGGAGGAGAGAGG - Intergenic
931689414 2:64822544-64822566 CAGCTTCTGGTGAGGGAATCAGG - Intergenic
932471538 2:71962623-71962645 CAGCTCAGGGAGGAGGAGTGTGG - Intergenic
932534767 2:72581642-72581664 CATCTCCTGGACAAGGAGTTTGG + Intronic
933022266 2:77208534-77208556 CAACTGTTGGAGAAGGAGTTGGG + Intronic
934236584 2:90238197-90238219 CAGCACCTGGAGACGGGGGCTGG + Intergenic
934572606 2:95382360-95382382 CATCTCCTGGAGGGGGAGGCTGG - Exonic
935355536 2:102196123-102196145 CAGCACTTGGAGATGGACTCAGG + Intronic
935627259 2:105181398-105181420 CAGCTCCTGGCCGAGGAGCCAGG - Intergenic
936050092 2:109216090-109216112 CAGCTGCTGGAGGAGGAACCCGG + Intronic
937864473 2:126738547-126738569 CAGTGCCTGGAAAAGGAGTATGG + Intergenic
937988303 2:127648511-127648533 CAGCCCCTCGAGGAGGAGGCTGG - Intronic
938781409 2:134588185-134588207 CAGATCCTGGAGAATCAGCCAGG + Intronic
939284442 2:140110812-140110834 CAGCCCCTGTGGTAGGAGTCAGG - Intergenic
942161378 2:173191855-173191877 AAGCTCCTGGAGGAGGAATTTGG + Intronic
942342833 2:174967228-174967250 CAGCTACTGGGGTAGGAGGCAGG + Intronic
944565597 2:200987307-200987329 CAGTTGCTGGAGAAGGATCCTGG - Intronic
945315951 2:208370893-208370915 CAGCTCCTGGTGAGGGCTTCAGG + Intronic
946764899 2:223031412-223031434 CTGCTCCTGGATTAGGGGTCTGG + Intergenic
946998527 2:225425190-225425212 CAGCTACAAGAGAAGGAATCAGG + Intronic
948455959 2:238104732-238104754 CAGTTCCTGGTGAAGGACTGTGG + Exonic
948657252 2:239484268-239484290 CAGCTCCTGCAGAAGAAGCGAGG + Intergenic
948916953 2:241039276-241039298 CACCTCCTGGGGGAGTAGTCAGG + Intronic
1168807850 20:683148-683170 CAGCTCCTTGAGTGGGATTCCGG + Intergenic
1168881445 20:1209546-1209568 CAGATGCTGGACAAGGAGTTGGG + Intergenic
1169503981 20:6188645-6188667 CAGGTCTTGGAGAATGAGTAGGG - Intergenic
1169504877 20:6198777-6198799 CTGCTCCTGGTGAAGGCCTCAGG + Intergenic
1171248743 20:23633416-23633438 CAGCCCCTGGTGAGGGGGTCAGG - Intronic
1171255248 20:23685394-23685416 CAGCCCCTGGCGAGGGGGTCAGG - Intergenic
1171262584 20:23747316-23747338 CAGCCCCTGGTGAGGGGGTCAGG - Intergenic
1171283175 20:23918296-23918318 CAGCCCCTGGTGAGGGGGTCAGG - Intergenic
1172092969 20:32446672-32446694 CAGCTCCTGGACACCCAGTCTGG + Exonic
1172131110 20:32656083-32656105 CTGCTCCTGGAGTAGGCCTCAGG - Intergenic
1172867199 20:38109469-38109491 AAGATCCTGGAGAAGGACCCTGG + Intronic
1172916494 20:38447407-38447429 AAGGTCCTGGCAAAGGAGTCTGG - Intergenic
1173940359 20:46905683-46905705 CAGCTCCTGGAGAGGGTATGGGG + Intronic
1174227449 20:49013598-49013620 TAGCTCCTGGTGACAGAGTCTGG + Exonic
1174402968 20:50285768-50285790 CAGCTCCTGGAGACTGAGGTGGG + Intergenic
1175614573 20:60384915-60384937 CAGCTCCTTGGAAAGTAGTCTGG + Intergenic
1175871156 20:62210148-62210170 CGGATCCTGGAGCAGGAGGCAGG - Intergenic
1175973272 20:62697936-62697958 CAGCACCTGCCGATGGAGTCGGG + Intergenic
1176614779 21:9018117-9018139 CATCTCCTGGACATGGGGTCTGG + Intergenic
1176710430 21:10145754-10145776 CATCTCCTGGACATGGGGTCTGG - Intergenic
1176717388 21:10364586-10364608 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1178205079 21:30455710-30455732 CAGCTTCTGGTGAGGGAATCAGG + Intergenic
1179235078 21:39538682-39538704 CAGCTTCTGGAGAAGATCTCAGG - Intergenic
1180041089 21:45280505-45280527 CTGCTCCTGGAGCAAGAATCTGG - Intronic
1180068346 21:45424003-45424025 CAGGTCCTGCAGACGGAGCCGGG + Intronic
1180298612 22:11017506-11017528 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181067381 22:20313305-20313327 GAGCTGCTGGAGGTGGAGTCAGG + Intergenic
1181164819 22:20977585-20977607 CAGCCCCTGGAGGATCAGTCTGG + Intronic
1181309037 22:21933804-21933826 TGGCTCCTGGTGCAGGAGTCAGG + Intronic
1181455561 22:23058443-23058465 AAGCTCCTGGAGAAAGAGTAAGG + Intergenic
1181492091 22:23266883-23266905 GAGCTCCTGGAGCAGGAGGGAGG + Intronic
1181845055 22:25700110-25700132 AGGCACTTGGAGAAGGAGTCTGG + Intronic
1181853955 22:25769205-25769227 CAGCTCCTGGGAAGGGAGGCTGG + Exonic
1181864501 22:25844774-25844796 CAGCTCCTGGAGAGAGATTCAGG + Intronic
1182070674 22:27461585-27461607 GAGCTCCTGGAGAATGAGGTTGG + Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182105437 22:27685775-27685797 CGCCTCTTGGAGAGGGAGTCTGG - Intergenic
1183167798 22:36160758-36160780 CAGAGCCTGGAGAACGTGTCTGG - Exonic
1183713615 22:39520945-39520967 GGGCTCCTGGGGAAGCAGTCCGG - Exonic
1183841638 22:40502732-40502754 CAGCGGCTGGAGAAGCAGACGGG - Intronic
1184236519 22:43186149-43186171 CAGCACCTGGAGGAGATGTCGGG + Intronic
1184238980 22:43201838-43201860 CAGCTCCTGAGGAAGGTGCCGGG - Exonic
1184242795 22:43220297-43220319 CAGCTTCTGGAGACAGAGGCAGG - Intronic
1184522043 22:45000341-45000363 CGGCTGCTGAAGAAGGAGTGTGG + Intronic
1184621011 22:45676889-45676911 CAGCTACTGGGGAAGGAGGCAGG - Intronic
1185119194 22:48955755-48955777 CTGCTCATGGACAAGGAGACAGG + Intergenic
950013753 3:9742097-9742119 CAGCTCCAAGAGAAGGACACAGG + Exonic
950035794 3:9884587-9884609 GAGGTTCTGGAGAAAGAGTCGGG + Intergenic
950640947 3:14347573-14347595 CATCCCCAGGAGAAGGAGTGTGG + Intergenic
951027618 3:17846315-17846337 CAGCAGCTGGAGAGGAAGTCAGG - Intronic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
957531078 3:81441540-81441562 CTGCTCCTGGTGAAGGCCTCAGG - Intergenic
957895277 3:86413293-86413315 CACCTCCTCGAAAAGGAGGCAGG + Intergenic
959872467 3:111343713-111343735 CACCTCCTTGAGAAAGAGTGTGG + Intronic
960716473 3:120580051-120580073 CAGTTCCTGGAGTAGGGGTGGGG + Intergenic
961056692 3:123794609-123794631 CAGGCCCTGGACCAGGAGTCAGG - Intronic
961093271 3:124133660-124133682 ATGTTCCTGGAGAAGGAGTTTGG + Intronic
961465225 3:127077251-127077273 GTACTCCTGGAGAAGTAGTCTGG + Intergenic
961482717 3:127194622-127194644 CAACTCCTGGAAAAGGGGGCAGG - Intronic
962266594 3:133948568-133948590 AAGTTCCTGGAGAAGCAGTATGG - Exonic
962442056 3:135429471-135429493 CAGCTGCTGGTGTAGGAGTTGGG + Intergenic
963234627 3:142945019-142945041 CAGCTCCTGGAGAAGGGGAAGGG + Intergenic
963646821 3:147925329-147925351 CACCTACTGGAGAAGGAGCTGGG + Intergenic
963687191 3:148451102-148451124 CTGCTCCTGGTGAGGGACTCAGG - Intergenic
966647208 3:182259809-182259831 CAGCAGCTGGTGGAGGAGTCAGG + Intergenic
967967455 3:194973441-194973463 GAGGTCCTGGAGCAGGAGTCTGG - Intergenic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968644165 4:1730648-1730670 CAGCTCTGGGAGAAGCAGGCTGG - Intronic
968707086 4:2084346-2084368 CAGCTCCATGAGATGGAGGCTGG + Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
968919474 4:3515209-3515231 CAGCCCCTGGACATGGGGTCTGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
969109934 4:4838296-4838318 GAGCTCCTGGAGCAGGAATTAGG + Intergenic
969231511 4:5835066-5835088 CACATACTGGAGAAGGAGTATGG - Intronic
969526663 4:7707328-7707350 CAGCTCCTGGCCAAGGAGGATGG + Intronic
970223209 4:13831468-13831490 CAGCTGCAGGAGAATGAGTAAGG - Intergenic
970604678 4:17667956-17667978 CAGCTCCTGGGGCAGCAGCCAGG + Intronic
971642892 4:29158242-29158264 CAGCCCCTAAAGAAGGAGTAGGG + Intergenic
972636297 4:40886867-40886889 CGGCCCCTGGAGATGGAGGCTGG - Intronic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
975663513 4:76710349-76710371 CAGCTGCTGGGAGAGGAGTCGGG + Intronic
976463824 4:85344585-85344607 CTGCTTCTGGTGAAGGACTCAGG - Intergenic
979622441 4:122812164-122812186 CACCTCCTGGACAAGGCGGCTGG - Intergenic
979622488 4:122812291-122812313 CACCTCCTGGACAAGGCGGCTGG - Intergenic
982710857 4:158757518-158757540 CAGCTCCTAGAGAAGTAGAATGG - Intergenic
985947191 5:3194977-3194999 CAGCCCCTGCAGAAGGTGCCTGG + Intergenic
985959330 5:3287808-3287830 CAGCTCCTGGAGCAGGAGGCTGG + Intergenic
985986497 5:3520851-3520873 CAGCTGCTGCAGCAGGAGCCAGG + Intergenic
985998410 5:3610816-3610838 CAGCTCCTGGGGGAGGGGCCTGG + Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
988111829 5:26831942-26831964 CAGCTTCTGGTGAAGGCCTCAGG - Intergenic
990161451 5:52944328-52944350 TGGCTCCTGGAGAAGGGGTGAGG - Intronic
992681191 5:79154851-79154873 CTGCTACTGGAAAAGGAGTTTGG + Intronic
995247214 5:109948016-109948038 AAGCTCCTGGAGAAGGGGTAAGG - Intergenic
995250297 5:109985451-109985473 CAGCTCCTGGTGAGGGCTTCAGG + Intergenic
995260270 5:110095948-110095970 CAGCTTCTGGTGAAGGCTTCGGG + Intergenic
995512373 5:112921996-112922018 CAGCTGCTGGGGAAGGAAGCAGG - Intronic
996054673 5:118969400-118969422 ATGCTCCTGTAGAAGGTGTCTGG - Intronic
999173904 5:149618271-149618293 CAGCTGCTGAAGCAGGAGGCGGG + Exonic
999633312 5:153594120-153594142 CAGCTTCTGGAGGAGGAGAAGGG - Intronic
999687628 5:154117037-154117059 CAGCTCCTGGTAAAGGAGACTGG - Intronic
1000699739 5:164433888-164433910 CAGTTGCTGGAAAAGGAGTGCGG + Intergenic
1001933881 5:175691249-175691271 CCACTCCTGGAGAGGAAGTCAGG + Intergenic
1001970848 5:175953880-175953902 CAGCTCTTGGAGAAGGTTTGAGG - Intronic
1002246590 5:177889884-177889906 CAGCTCTTGGAGAAGGTTTGAGG + Intergenic
1002511338 5:179720463-179720485 CAGCTCCTGGATGTGGTGTCTGG + Exonic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1003673601 6:8182165-8182187 CAGCTTTTTGAGAAAGAGTCTGG - Intergenic
1005875208 6:30006249-30006271 CAGCTCCTGGACCAAGACTCAGG + Intergenic
1005922968 6:30417274-30417296 CAGCTCCTGGAGGAGGCGCGTGG - Intergenic
1006485539 6:34338030-34338052 CAGTTCCTACAGAAAGAGTCAGG + Intronic
1006610373 6:35291092-35291114 CTGCTCCTGGAGAGGGAAGCAGG + Intronic
1006634566 6:35452622-35452644 CAGCGCCTGCAGCAGGAGGCGGG - Exonic
1013409866 6:109874379-109874401 AAACTCCTGGAGAAGGTGCCTGG - Intergenic
1015552719 6:134428792-134428814 CAGGTTGTGGAGAAGGAGACTGG + Intergenic
1016240789 6:141927402-141927424 CAGTTCCTGGAGTAGGGGTGGGG + Intergenic
1017037627 6:150280624-150280646 CAGCTCATTAAGAAGGAGGCAGG + Intergenic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1018689536 6:166333622-166333644 CACCTCCTGGAGCAGGAGGAGGG - Intronic
1019258617 7:67333-67355 CAGCTCTTGGAGAAGGACTGAGG - Intergenic
1019613126 7:1946938-1946960 CAAGTCCTGGAGGAGGAGGCTGG + Intronic
1020013354 7:4818010-4818032 CAGCACCTGGGGAAGGGGCCAGG + Intronic
1020397816 7:7736979-7737001 CAGCTTCTGGAGAAGCAGTGGGG - Intronic
1021197326 7:17688024-17688046 CCTCTCCTGGAGAAAGAGACAGG + Intergenic
1022715119 7:32891799-32891821 CGGCTCCCGGGGGAGGAGTCTGG - Exonic
1023037991 7:36149639-36149661 CAGCTCCGGGAATAGAAGTCAGG + Intergenic
1023601426 7:41885248-41885270 CAGCTCCTGGAGAAGCAGGGAGG + Intergenic
1023646642 7:42324240-42324262 CAGCTCCTGTGGAAGCAGTTTGG + Intergenic
1024011112 7:45267477-45267499 CAGCTCCGAGAGAAGGAGCTGGG + Intergenic
1026358989 7:69585456-69585478 CTGCTCCTGGTGAAGGACTCAGG - Intergenic
1026868552 7:73836789-73836811 CAGCTCATTGAGAACGAGCCAGG + Intronic
1027186936 7:75977995-75978017 CAGCTGCTGGAGGAGGAGGGTGG + Intronic
1028187694 7:87807433-87807455 GAGCTCCTGGAGAAGGCCACTGG - Exonic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1032004141 7:128286484-128286506 CAGTTCCTGGAGAGGGACCCAGG - Intergenic
1032211378 7:129917407-129917429 TAGCTGATGGAGAAGGAGTAGGG - Intronic
1032960883 7:137032803-137032825 CAGCTCCTGGAGGATGAGATGGG + Intergenic
1033673165 7:143511988-143512010 CTGCGCGTGGAGGAGGAGTCGGG + Intergenic
1033824099 7:145168645-145168667 CAGATCCTGGTGAACGAGGCGGG - Intergenic
1033989474 7:147265730-147265752 ATGCTCCTGGATAAGGTGTCTGG - Intronic
1034354020 7:150436510-150436532 ATGCTCCTGGTGAAGGAGTCAGG - Intergenic
1034523552 7:151639579-151639601 CAGCTCCAGGAGAAAGAGCAAGG - Intronic
1035783666 8:2247405-2247427 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783679 8:2247443-2247465 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783692 8:2247481-2247503 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783703 8:2247519-2247541 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783729 8:2247595-2247617 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783742 8:2247633-2247655 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783767 8:2247709-2247731 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783819 8:2247861-2247883 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783832 8:2247899-2247921 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783845 8:2247937-2247959 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783883 8:2248050-2248072 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783896 8:2248088-2248110 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783909 8:2248126-2248148 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783945 8:2248240-2248262 CAACTCCAGGAGGAGGAGTCAGG + Intergenic
1035783969 8:2248316-2248338 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035783993 8:2248392-2248414 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784015 8:2248468-2248490 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784027 8:2248506-2248528 CAACTCCAGGAGGAGGAGCCGGG + Intergenic
1035784051 8:2248582-2248604 CAACTCCTGTAGGAGGAGCCAGG + Intergenic
1035784065 8:2248620-2248642 CAACTCCAGGAGGAGGAGCCGGG + Intergenic
1035784077 8:2248658-2248680 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784198 8:2249038-2249060 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784211 8:2249076-2249098 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784224 8:2249114-2249136 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784236 8:2249152-2249174 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784260 8:2249228-2249250 CACCTCCAGGAGGAGGAGCCAGG + Intergenic
1035784274 8:2249266-2249288 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784286 8:2249304-2249326 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035784470 8:2249912-2249934 CAACTCCAGGAGGAGGAGCCAGG + Intergenic
1035808339 8:2471801-2471823 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808373 8:2471915-2471937 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808386 8:2471953-2471975 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808399 8:2471991-2472013 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808422 8:2472067-2472089 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808448 8:2472143-2472165 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808461 8:2472181-2472203 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035808518 8:2472371-2472393 CAACTCCAGGAGGAGGAGCCAGG - Intergenic
1035992336 8:4506353-4506375 GGGCTCATGGAAAAGGAGTCTGG - Intronic
1036681572 8:10878218-10878240 CTGCTTCTGAAGAAGGAATCTGG - Intergenic
1036810720 8:11866528-11866550 CAGCTCCTGGAGAAAGGGGCTGG - Intronic
1036943337 8:13071678-13071700 AAGCGCCTGCAGAAGGAGGCAGG - Intergenic
1037751038 8:21682626-21682648 CAGGCCCTGGAGAAGGAAACGGG - Intergenic
1038684180 8:29701315-29701337 CACCTATTGGAGAAGGAGCCTGG + Intergenic
1038732981 8:30144244-30144266 CAGCTCCTCGGGAGGGAGGCAGG - Intronic
1039159111 8:34596860-34596882 CTGCTCCTGGTGAGGGACTCAGG + Intergenic
1039320499 8:36424982-36425004 CAGCTCCTGCCCAAGGATTCAGG + Intergenic
1039580587 8:38663412-38663434 AAGCTCCAGGAGAGGGAATCTGG + Intergenic
1041162972 8:55063583-55063605 AAGCTACTAGAGAAGGAGGCCGG + Intergenic
1041533815 8:58903357-58903379 TAGCTCTTGCAGAAGGAGGCGGG + Intronic
1045102850 8:98862762-98862784 CATCTACTGAAGAAGGAGTCAGG + Intronic
1045965499 8:108020117-108020139 CATCTCCTGGAGAGGGCTTCTGG - Intronic
1046981646 8:120342794-120342816 CAGCTTCTGAAGATGTAGTCTGG - Intronic
1048031629 8:130638763-130638785 AAGATACTGGAGAAGGAGTGTGG + Intergenic
1048211524 8:132458090-132458112 CAAGTCCTGGACCAGGAGTCAGG - Intronic
1048527613 8:135217605-135217627 TATCTCCTGGAGCTGGAGTCTGG + Intergenic
1048950120 8:139489757-139489779 CAGCCCCTGCAGAAGGAAACAGG + Intergenic
1049392028 8:142376673-142376695 CATGGCCTGGAGAAGGTGTCAGG + Intronic
1049475469 8:142795149-142795171 AAGCTCCTCGGGCAGGAGTCAGG + Intergenic
1050918972 9:11175012-11175034 CAGGTGCTGGAGAAGGAGAGAGG + Intergenic
1053120858 9:35546767-35546789 CAGCACCAAGAGTAGGAGTCGGG + Exonic
1053647409 9:40131452-40131474 CATCTCCTGGACATGGGGTCTGG - Intergenic
1053758318 9:41332391-41332413 CATCTCCTGGACATGGGGTCTGG + Intergenic
1054328395 9:63729406-63729428 CATCTCCTGCACATGGAGTCTGG - Intergenic
1054537170 9:66244718-66244740 CATCTCCTGGACATGGGGTCTGG + Intergenic
1056510943 9:87305194-87305216 AAGCTGCTGGAGAAGTTGTCAGG + Intergenic
1056812776 9:89777121-89777143 CAGTTCCTGGAGTGGGAGTAAGG + Intergenic
1058297482 9:103327136-103327158 GGGCTCCTGGAGAAGGATTCTGG - Intergenic
1058872415 9:109213922-109213944 GAGCTGCTGGAGGAGGAGGCCGG - Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1061515896 9:131090338-131090360 GGGCTCCTGGAGAAGGGGCCAGG - Intronic
1061551080 9:131335031-131335053 GGGCACCTGGAGAAGGAGTAGGG - Intergenic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062198790 9:135289684-135289706 CATCTCCTTGAAAAGGAGTGCGG + Intergenic
1062373723 9:136252836-136252858 CCGCTCCTGGAGACAGACTCAGG - Intergenic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1202795194 9_KI270719v1_random:114749-114771 CATCTCCTGGACATGGGGTCTGG - Intergenic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1188813278 X:34679895-34679917 CAGCTTCTTCACAAGGAGTCAGG + Intergenic
1189041091 X:37542828-37542850 CAGCACCTGTAGTAGGAGACTGG + Intronic
1190789003 X:53682634-53682656 CAGCTCCTGGAAAAGGAGTATGG + Intronic
1191691488 X:63943589-63943611 AAGCTCCTAAGGAAGGAGTCAGG - Intergenic
1194423937 X:93713649-93713671 CAGCTTCTGGTGAAGGCCTCAGG + Intergenic
1196777492 X:119352816-119352838 CAGCTCCTGGTGAGGGCTTCAGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197510014 X:127359590-127359612 CAGCTTCTGGAGCATGAGTGAGG + Intergenic