ID: 968864568

View in Genome Browser
Species Human (GRCh38)
Location 4:3199714-3199736
Sequence CATTCCTAGAAACAAAGTTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968864568_968864573 24 Left 968864568 4:3199714-3199736 CCTTAACTTTGTTTCTAGGAATG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG 0: 1
1: 0
2: 0
3: 10
4: 71
968864568_968864571 7 Left 968864568 4:3199714-3199736 CCTTAACTTTGTTTCTAGGAATG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 968864571 4:3199744-3199766 GAATCACAGCAGCTGCCACTAGG 0: 1
1: 1
2: 0
3: 102
4: 340
968864568_968864574 30 Left 968864568 4:3199714-3199736 CCTTAACTTTGTTTCTAGGAATG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 968864574 4:3199767-3199789 CTGTTCCGCAGTGATGGCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968864568 Original CRISPR CATTCCTAGAAACAAAGTTA AGG (reversed) Exonic
902670158 1:17967714-17967736 CAATCCTAGAATCCAAGTTGGGG + Intergenic
903571212 1:24306950-24306972 CATTACTAGAAAAAAAATCAAGG - Intergenic
905838707 1:41154179-41154201 CATTTCTTTAAACAAAGTTCTGG + Intronic
906468102 1:46103119-46103141 AAATCATAGAAACAAAGTAAAGG + Intronic
906611016 1:47202696-47202718 AATACCTAGAAATAAATTTAAGG + Intergenic
907945275 1:59130313-59130335 GAATCCTAGAAACAAGGTTTGGG + Intergenic
908583047 1:65537931-65537953 TGTTCCTAGAATCAAAGTTAAGG + Intronic
910494950 1:87816449-87816471 CATTTCTAGAAACATAAATAGGG + Intergenic
912064563 1:105720629-105720651 TATTCTTAGAAAAAAAGTAAGGG + Intergenic
912982823 1:114392546-114392568 CTTTCCTGGCAACAAAGTTTGGG + Intergenic
913005571 1:114627514-114627536 CATTCCTACATACAAATTTCTGG + Intronic
916330963 1:163616333-163616355 GACTCCTAGAAACAAATTAAGGG - Intergenic
917459300 1:175215625-175215647 CACTCCTACATACAAATTTAAGG + Intergenic
922659553 1:227417997-227418019 AATGCCTAGAAAGAAAGATAGGG + Intergenic
923349960 1:233094650-233094672 CATTCCTGTACACCAAGTTAAGG + Intronic
923443424 1:234043291-234043313 CATTAACAGAAACAATGTTAAGG - Intronic
923649551 1:235861394-235861416 CATTACTGTAAACAAAGTTGGGG + Intronic
923674777 1:236070663-236070685 CATCTCTAAAAAAAAAGTTAAGG - Intergenic
924173641 1:241367070-241367092 CATTTCTAGAAATATAGTGATGG + Intergenic
1063201296 10:3786666-3786688 CATTCCTGGAAACAGAGTTAAGG - Intergenic
1063435970 10:6030831-6030853 CAGTCCTAGTATAAAAGTTAGGG + Intronic
1064121585 10:12623596-12623618 CATTCTGAGGAACAAACTTAGGG + Intronic
1065229569 10:23583463-23583485 CATTCCTAGAAACACAAAAATGG - Intergenic
1065876600 10:30002402-30002424 CATTTTTAGAAATAAAGTTGGGG + Intergenic
1069372545 10:67763381-67763403 CATTTCTCGAAACCAAATTATGG - Intergenic
1069434896 10:68372106-68372128 CATTTCTAAAAAAAAATTTAAGG + Intronic
1069759956 10:70802573-70802595 AGTTCCTAGAAACAAAGATATGG - Intergenic
1071022267 10:81071489-81071511 AATTCCTTGAAACAGAGTTTGGG + Intergenic
1073869224 10:107843331-107843353 CTTTCCTGGAAACACAGCTATGG - Intergenic
1076185748 10:128447189-128447211 CATTATTAGAAATAAAGTTTGGG - Intergenic
1082183427 11:49148037-49148059 AATCCCTAGAAAGAAAGTTAGGG + Intronic
1086682937 11:89697304-89697326 AATCCCTAGAAAGAAAGTTAGGG - Intergenic
1089885494 11:121818362-121818384 CATTACAAGAAAAAAAATTATGG - Intergenic
1089924831 11:122246466-122246488 CAATGGTAGACACAAAGTTAGGG - Intergenic
1091096345 11:132825828-132825850 GAGTCCTAGAAACAAAGCTAAGG + Intronic
1092687520 12:11067981-11068003 CATTCCTACATATAAAATTAGGG - Intronic
1093929988 12:24946252-24946274 CATGTCTAGAAATAAAGCTAGGG - Intronic
1097142802 12:56916970-56916992 CAATCCTGGAAGAAAAGTTACGG - Intergenic
1097483454 12:60162695-60162717 CGTTCTTAGAAAAAAAGATAAGG + Intergenic
1099043274 12:77682425-77682447 TATTCCTAAAAACCAAGATATGG - Intergenic
1099284152 12:80694417-80694439 CAGTCCTAGAAACTAAGATTTGG + Intergenic
1102210809 12:111125635-111125657 CATTCCTAGCAACAAATGAATGG - Intronic
1105548358 13:21368569-21368591 CATTTCTAGAAGCAATGTTTGGG + Intergenic
1106311972 13:28562727-28562749 CACTCCCAGAAAGAAAGTGAAGG + Intergenic
1106898595 13:34331779-34331801 AATTACGAGAAACAAATTTAGGG + Intergenic
1107129364 13:36879104-36879126 CATTCCGGGAAACAAAATTTTGG + Intronic
1108079407 13:46719165-46719187 CACACCTAGAAACTAAGTTTAGG + Intronic
1108788182 13:53932527-53932549 CATTCCCAGACTCAAAGTGAAGG - Intergenic
1108977189 13:56461959-56461981 CATGCATAGAATCAAAGTAAAGG - Intergenic
1109159242 13:58951173-58951195 CATTCCTAGAAACACTGTGTGGG - Intergenic
1109935231 13:69274132-69274154 AATTCCTAGACACAAAATAAGGG - Intergenic
1110518457 13:76444997-76445019 AAATACAAGAAACAAAGTTATGG + Intergenic
1113495971 13:110729590-110729612 CAAACCTAGAAACAAAGATCTGG + Intergenic
1114591441 14:23868495-23868517 CCTTCCTAGAAACAAATCTCTGG + Intergenic
1115395046 14:32899253-32899275 CATTCCTAAAAACACTGTCAGGG - Intergenic
1118506728 14:66421587-66421609 CAGCCCTAGAATCAAGGTTAAGG - Intergenic
1122497234 14:102166683-102166705 CAATCCTCAAAACAAAATTAGGG - Intronic
1124469710 15:29972637-29972659 CATCCAAAGAAACAAAATTATGG + Intergenic
1125873980 15:43127750-43127772 CTTACCTAGAACCAAAGTCAAGG - Intronic
1126947320 15:53836316-53836338 TATTCCTAGAAGCACACTTAGGG + Intergenic
1133494910 16:6308796-6308818 CATTCTTAGAAAAATAGATATGG + Intronic
1133758430 16:8779574-8779596 AATTGCCAGAAACAAAGGTAAGG + Exonic
1134175555 16:12003258-12003280 GATTCCTAGAAAGAGAATTATGG - Intronic
1134556138 16:15166942-15166964 CCTTCCTAGAAACAAAATCTAGG + Intergenic
1134916721 16:18078677-18078699 CCTTCCTAGAAACAAAATCTAGG + Intergenic
1139221914 16:65191813-65191835 TAGTATTAGAAACAAAGTTAAGG + Intergenic
1141347797 16:83263502-83263524 CATTCCTATGAACCAAGTCAAGG - Intronic
1143847117 17:9780871-9780893 CATCCCTAGAAACACACTTTGGG + Intronic
1144868193 17:18350674-18350696 CAAACCTAAAAACAAAGTTCTGG - Intronic
1145770908 17:27492400-27492422 CATTCCTAGAAAGGAATTCACGG - Intronic
1146407868 17:32555021-32555043 AATTCCTAGAGACAGAGTTGCGG - Intronic
1148522603 17:48294880-48294902 CATTCCTGGAAAGAACTTTAAGG - Intronic
1149035720 17:52132695-52132717 CAGTTCTAGAAACAAATTTAGGG + Intronic
1149216610 17:54362063-54362085 CATTTCAAGAAACAGAATTAAGG + Intergenic
1151174933 17:72279849-72279871 CAGGACTAGAAACCAAGTTATGG - Intergenic
1151546000 17:74793549-74793571 CATTACTAGACACAAAATAAGGG - Intronic
1153916131 18:9746843-9746865 CATTGCCAAAAACAAAGTCATGG - Intronic
1155657115 18:28205230-28205252 CATTCCTAGAATCAAATTACAGG - Intergenic
1155672277 18:28386647-28386669 CATTCTTAGAAATAAACATAGGG + Intergenic
1156252521 18:35364752-35364774 TCTTCCTAGAAACAAAGTGGAGG - Intergenic
1157477842 18:48034868-48034890 CATTCCCAGAATCAAAGAAAAGG + Intronic
1158159673 18:54467111-54467133 TTTTCTTAGAAATAAAGTTAAGG - Intergenic
1162492702 19:11003322-11003344 CATACCTAGAAAAAATGTAAGGG - Exonic
1164003499 19:21128657-21128679 CATTCAGAGAAACAAAATTCAGG + Intergenic
1164017853 19:21268723-21268745 CATTCAAAGAAACAAAATTCAGG + Intronic
1164018267 19:21272801-21272823 CATCCCTAGAAAAAGGGTTAGGG - Intronic
1164030364 19:21397922-21397944 CATTCAGAGAAACAAAATTCAGG - Intronic
1164909938 19:32001126-32001148 CAATCCAAAAAACAAAATTAAGG + Intergenic
1165088930 19:33372419-33372441 GATTCCTCGAAACAATCTTACGG + Intergenic
1166295471 19:41887402-41887424 CAGTCCCAGAAACCAAGTGATGG - Intronic
925577587 2:5376536-5376558 CATTATTAGTAACAAAATTAAGG - Intergenic
928469261 2:31557466-31557488 CATTACAAGAAAAAAAATTATGG - Intronic
929427928 2:41863088-41863110 CAGTGCTAGAAACACAGGTAGGG - Intergenic
929455650 2:42063039-42063061 CATCCATAAAAACAAAGTTCAGG + Intergenic
930140183 2:47943530-47943552 CACTCCAAGAAGCCAAGTTAAGG - Intergenic
930191773 2:48466929-48466951 CAATCCTACAAACAAAGTGAAGG - Intronic
930548378 2:52799490-52799512 CATTCATAGTAGCAAAGATATGG + Intergenic
930843646 2:55876974-55876996 CATTCCTAGAAAAAATATTTCGG - Intronic
931197446 2:60066047-60066069 CACTCCTGAAAACAAACTTAGGG + Intergenic
931203488 2:60123994-60124016 CATTCCCAGCATCAAATTTATGG - Intergenic
933489255 2:82964660-82964682 CATTCCTAGAAGAAAACCTAGGG - Intergenic
935443719 2:103134735-103134757 TATTCCTAAAAAGAAAGTTGTGG - Intergenic
935852697 2:107240088-107240110 AATTCCTAGAAGCAAACGTAAGG + Intergenic
939048469 2:137278607-137278629 CATTCCTAGGAAGAAAGGGAGGG + Intronic
939620917 2:144418312-144418334 GTTTCCTAGAGAAAAAGTTAAGG + Intronic
941839273 2:170062259-170062281 CATTCCTATAAGCACAGTTTGGG - Intronic
942498135 2:176560735-176560757 CATTCCTAGCAACACACTTTGGG + Intergenic
942878332 2:180829482-180829504 CATTTATAGAACCACAGTTAAGG + Intergenic
943249163 2:185495249-185495271 CATTCTTAGAAAAAAACATATGG - Intergenic
943536636 2:189160362-189160384 CTTTCTTAGAGACAAAGTCAGGG - Intronic
943698335 2:190961049-190961071 CATTCCTAGAGGCCAATTTAGGG - Intronic
944108812 2:196108973-196108995 TATTCATAGAAAGAAAATTATGG - Intergenic
944440141 2:199734314-199734336 GATTCTTAGAAGCAAATTTAAGG + Intergenic
945344782 2:208700533-208700555 CATTCCCAGTAGCAAAGTCATGG - Intronic
945444543 2:209920657-209920679 TATTTGTGGAAACAAAGTTATGG - Intronic
945613091 2:212030550-212030572 CTTTCCAAGAAACAAGGGTAGGG + Intronic
945803886 2:214466354-214466376 CATTCATAGGAACAAAGATAAGG - Intronic
946934274 2:224703407-224703429 CAAGCCTAGAAAAAAAGTTCTGG - Intergenic
1169039275 20:2479836-2479858 CCTTCCTAGAAACAAAGGAGGGG + Intronic
1173675103 20:44827140-44827162 CATTTCTAGTAATAAAGATAAGG - Intergenic
1182750515 22:32638238-32638260 TATTCACAGTAACAAAGTTATGG - Intronic
1184855328 22:47143349-47143371 CATTCCTGAAAACAAAGAAAAGG + Intronic
950516127 3:13466666-13466688 CATTCCTAGGAATAAAGAGAAGG + Intergenic
951449989 3:22826416-22826438 CATTCCTATAAAAAAATTCAGGG + Intergenic
951543054 3:23801130-23801152 CATTCCTTGTAAGAAAGATAAGG - Intergenic
953776958 3:45827483-45827505 CATTACTAAAAAAATAGTTAAGG + Intronic
957286704 3:78225431-78225453 TATTAGTAAAAACAAAGTTAAGG - Intergenic
957478784 3:80762889-80762911 CATTACCAGAAAAAATGTTATGG - Intergenic
957508067 3:81151540-81151562 AATTCCTAGAAAAAAAATTCGGG + Intergenic
957647078 3:82944532-82944554 AATTACTAGAAACAAAGACAAGG - Intergenic
958082067 3:88759409-88759431 CATTCCAAGAAGCAAAATTTTGG + Intergenic
958558742 3:95714879-95714901 AATTCTTAGAACCAAAGTTGTGG + Intergenic
958973692 3:100641243-100641265 CATTTATATAAACAAAGTTTAGG + Intronic
960193300 3:114733173-114733195 CATTTATAGAAACAGACTTACGG + Intronic
964927180 3:161974263-161974285 CATGCCTAGAAACACAGTTTTGG - Intergenic
966376173 3:179297960-179297982 GATTCTTAGAAAAAAAGGTACGG + Intergenic
966585786 3:181622701-181622723 CATTCCTAAAAACTCAGTTCTGG + Intergenic
966894166 3:184429986-184430008 CATTCCTGGAAACAGAATTCTGG - Intronic
968720503 4:2199496-2199518 CATAGATAGAAACAAAGATAAGG + Intronic
968864568 4:3199714-3199736 CATTCCTAGAAACAAAGTTAAGG - Exonic
969913968 4:10471990-10472012 AATTCCCAGAAAAAAAGTGATGG - Intergenic
970385421 4:15551236-15551258 GATTCCTAGAAATAAAAGTAAGG - Intronic
971121791 4:23712703-23712725 CATTCCAAGAAAAAATGTCAAGG - Intergenic
972266215 4:37462668-37462690 CATTCAAAGAAACAAAGGAATGG - Intronic
974205801 4:58701786-58701808 CATTCTTAGAAACATAGAAAAGG + Intergenic
974251074 4:59383631-59383653 CATTTCTAGATCCAAAGTAAAGG + Intergenic
976383117 4:84423209-84423231 CATTCAGAGGAACAAAGATAAGG + Intergenic
976431832 4:84971226-84971248 CTTTCTTAGAAATAAAGCTAAGG + Intergenic
977021940 4:91770578-91770600 TATTCCTTGAACCAGAGTTAAGG + Intergenic
977718212 4:100208179-100208201 CATTCCTAGAACTAAGGTCAGGG - Intergenic
978624370 4:110667638-110667660 TAATCCTTGAAACAAACTTACGG - Intergenic
979063207 4:116094315-116094337 CATTCCTTGAATTAAAGTTAGGG - Intergenic
981425984 4:144603602-144603624 CATTCACAGAATCAAAGTAAAGG + Intergenic
983253401 4:165370678-165370700 CATTCCTAGAAAGAAACATAGGG - Intronic
984197472 4:176676462-176676484 CATTTTTACAAATAAAGTTATGG - Intergenic
985029635 4:185776068-185776090 TATTTCTAGAAACAAAATGAAGG - Intronic
986600366 5:9467029-9467051 CTTCCCCAGAAACAAAGTTTTGG + Intronic
986947782 5:13045940-13045962 CTTTCTTAGAAATAAAGTTGGGG - Intergenic
987168800 5:15231015-15231037 CATTCCAACAAAAAAACTTAAGG + Intergenic
987870345 5:23609813-23609835 CAATCATAGAAAAAAAATTAAGG - Intergenic
989222195 5:38979809-38979831 CAGTTTTAGAAACAAAGTTTTGG + Intronic
993655567 5:90574451-90574473 CATTTCTATACACAAAGTTCAGG - Intronic
996406846 5:123113909-123113931 CATTCAGAGAAACACATTTATGG + Intronic
997160390 5:131602369-131602391 TATTCCTAGGAATAAAATTATGG - Intronic
1000219150 5:159195285-159195307 CATTCTTTGAAACAAAGGTAAGG - Intronic
1000884235 5:166733050-166733072 CATTCCAAGAAAGGAAGTTCTGG + Intergenic
1002076237 5:176710139-176710161 TTTTCCTAGAAACAAAGAAATGG - Intergenic
1003985322 6:11429193-11429215 CAATCCTAGAAGCCAAGTTATGG + Intergenic
1005632589 6:27722465-27722487 CATTCCTAGAAGAAGAGATACGG + Intergenic
1006343910 6:33464434-33464456 CATGCCAAGAAACAAAATTAAGG + Intergenic
1008783005 6:55129931-55129953 CATTACTAAATACAAAGTAAGGG - Intronic
1009202468 6:60762585-60762607 GACACCTAGAAACAAAGTAAAGG + Intergenic
1009530996 6:64815346-64815368 CATATCTAGAAACAGAGTTAGGG - Intronic
1011733385 6:90289506-90289528 CATTCTTAGATGCAAAATTAAGG - Intronic
1011814326 6:91170742-91170764 AATTCCCCAAAACAAAGTTAAGG - Intergenic
1013185527 6:107754453-107754475 CATTCCTAGAAAGGCAGTTAGGG - Intronic
1013834611 6:114318879-114318901 CATTCTTAGAAAAAAGATTATGG - Intronic
1014895964 6:126899387-126899409 CATACCTAGAAATAATGTTTAGG - Intergenic
1016403231 6:143702902-143702924 CTTTCCCAGAAACCAAGTAAGGG + Intronic
1017303714 6:152891955-152891977 CATTCCTAGGAACCAAATCATGG - Intergenic
1018276416 6:162136785-162136807 AATTCCAAGTAACAAAGCTAGGG + Intronic
1019317243 7:392541-392563 CATTCTTAAAAACAACTTTAGGG + Intergenic
1020583632 7:10036338-10036360 TATGCATAGAAAAAAAGTTAAGG + Intergenic
1020650799 7:10873867-10873889 CACTCCCAGAAACACAGTTTGGG + Intergenic
1020860075 7:13481454-13481476 TATTCCAAGAAATAAAGTCATGG + Intergenic
1022193053 7:28035978-28036000 CATTGTTAGAAAAAAAGATAAGG - Intronic
1023206484 7:37756132-37756154 AATTCCTGGAAAAAAAGATAGGG + Intronic
1024598147 7:50957102-50957124 CATCCCTAGAAGGAAAATTAAGG - Intergenic
1025521976 7:61746446-61746468 CATTCTGAGAAACAAATTTGTGG - Intergenic
1027948960 7:84787984-84788006 AATGCCTATAAACAAAGTAAAGG - Intergenic
1030117447 7:106072846-106072868 AATTTCTAGAAAAAAATTTATGG - Intergenic
1030264794 7:107608561-107608583 CATTCTTAGAATCAATGTTTAGG + Intronic
1030421502 7:109311791-109311813 CATTCATAGTTTCAAAGTTAAGG + Intergenic
1030571275 7:111227785-111227807 AATTCCTAGAAACAGAATTCTGG + Intronic
1030807997 7:113939352-113939374 CATTCATAGAATGAAAGATAAGG - Intronic
1031326228 7:120401959-120401981 AATTTCTAAAAACAAAATTAGGG + Intronic
1032252097 7:130266826-130266848 CATCCCTACAAATAAAGTTCAGG + Exonic
1032647934 7:133846562-133846584 AATTCCTAGAAACAAAAGTATGG - Intronic
1033986519 7:147232724-147232746 TATTCCTAGAAAAAAACGTAGGG + Intronic
1034596520 7:152199673-152199695 CTTTACTAGAGACAAAATTATGG + Intronic
1035822955 8:2614601-2614623 TATGCCTAGAAACACATTTAAGG + Intergenic
1039044531 8:33437852-33437874 CATTTCTAGATATAAAGTTTTGG + Intronic
1039309907 8:36306114-36306136 CATACCTGGATACAAAATTAAGG - Intergenic
1041112722 8:54501520-54501542 CATCCAGAGAAACAAAGATAAGG - Intergenic
1041605323 8:59775641-59775663 CATTCCTTGTTACAAAGCTAAGG - Intergenic
1043975075 8:86575662-86575684 AAGTCCTAGAAACTAAGCTAGGG + Exonic
1044592367 8:93926647-93926669 AATTTCTAGAAGCAAAATTATGG - Intergenic
1044872602 8:96634149-96634171 AATTCATAGAAACAAAATGATGG - Intergenic
1044874384 8:96649960-96649982 CATTCAAAGGAACAAAGATAAGG + Intronic
1046283821 8:112069812-112069834 CATTCTTGGAATCAAAATTATGG - Intergenic
1046996114 8:120525293-120525315 CATTCCTGGGAACAGAGTAATGG + Intronic
1048453940 8:134560522-134560544 CATTTCTATCAACAGAGTTAGGG + Intronic
1048883593 8:138890450-138890472 CATCCCTAAAAAAAAAGATAAGG - Intronic
1049769922 8:144374964-144374986 CATTCCAAGAAAAAAAGGAACGG - Intronic
1050378777 9:5002113-5002135 CTTTTCTAAAAACAAAGTTTTGG + Intronic
1053090044 9:35266866-35266888 CATTTCTTGAAAGAAAGGTAAGG + Intronic
1053440389 9:38111435-38111457 CATTCTTAGAAGTAAAATTATGG - Intergenic
1054875089 9:70087626-70087648 CATTCCTGGAAAGGGAGTTAAGG + Intronic
1054947865 9:70815365-70815387 AATTCCTAGAAGTAAAATTATGG + Intronic
1055590021 9:77802615-77802637 CATTCCTACAAAACAAATTATGG - Intronic
1057173357 9:92976790-92976812 CATTCCTGGAAACAAGGTGTGGG - Intronic
1058161712 9:101577219-101577241 CATTCCTAGGAACAGAGTATTGG - Intronic
1058535827 9:105958995-105959017 CTTTCCTAGTAACAAAGTCATGG + Intergenic
1058957968 9:109966929-109966951 CAATCCTAGAAACACCGTGATGG - Intronic
1185665892 X:1765313-1765335 CATTCCTAGACACACAGACAAGG - Intergenic
1185962971 X:4565823-4565845 CTTCCCTAGAGACAATGTTATGG + Intergenic
1186976788 X:14916297-14916319 AGTTCCCAGAAACAAAGTGATGG + Exonic
1187465467 X:19522888-19522910 CAATCCTGGAAAAAAAGTAAAGG - Intergenic
1187998068 X:24950658-24950680 CATTCTTTGTAACAAAGTCAGGG + Intronic
1188170582 X:26918980-26919002 CATTCACAGTAACAAAGATATGG - Intergenic
1188713018 X:33425192-33425214 CATTCATAATAACAAAGATATGG - Intergenic
1189019926 X:37324591-37324613 CATTCATTGAAACAAACATATGG - Intergenic
1189946368 X:46184112-46184134 CATTACTAGAAACAAATTAATGG + Intergenic
1193866027 X:86730902-86730924 CATTCCTAAAAAGAAGGTTATGG + Intronic
1194280563 X:91948041-91948063 ATTTCCTAGAAGCAAATTTAAGG + Intronic
1194517637 X:94876641-94876663 CATTCATAGGCACAAAGTGAAGG - Intergenic
1195539903 X:106051627-106051649 AATTACTAGAAAAAAAATTAAGG + Intergenic
1197095548 X:122590331-122590353 AATTCCAGGAAACTAAGTTATGG + Intergenic
1197394887 X:125915149-125915171 CATTCCCAATAGCAAAGTTATGG + Intergenic
1197574125 X:128187950-128187972 CATTGCTGGATACAATGTTATGG - Intergenic
1197617418 X:128709780-128709802 AATTCCTAGAAAAAAACTTAAGG + Intergenic
1198112901 X:133518097-133518119 CATTCTTAGAAAAAAACATAAGG - Intergenic
1199187006 X:144927052-144927074 CATTCCCACCAACAATGTTAAGG - Intergenic
1199246227 X:145607603-145607625 CATTCCCAGAAACAGTGTAAAGG - Intergenic
1200598039 Y:5171537-5171559 ATTTCCTAGAAGCAAATTTAAGG + Intronic
1202083896 Y:21114954-21114976 CCTTATGAGAAACAAAGTTATGG + Intergenic
1202328524 Y:23720098-23720120 CATACCAAGAAACAAATTAATGG + Intergenic
1202542247 Y:25949955-25949977 CATACCAAGAAACAAATTAATGG - Intergenic