ID: 968864570

View in Genome Browser
Species Human (GRCh38)
Location 4:3199739-3199761
Sequence TGGCAGCTGCTGTGATTCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968864570_968864577 25 Left 968864570 4:3199739-3199761 CCGGAGAATCACAGCAGCTGCCA 0: 1
1: 0
2: 4
3: 31
4: 369
Right 968864577 4:3199787-3199809 TGGCGGCAGTTTCTACACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 78
968864570_968864575 8 Left 968864570 4:3199739-3199761 CCGGAGAATCACAGCAGCTGCCA 0: 1
1: 0
2: 4
3: 31
4: 369
Right 968864575 4:3199770-3199792 TTCCGCAGTGATGGCTGTGGCGG 0: 1
1: 0
2: 1
3: 34
4: 215
968864570_968864574 5 Left 968864570 4:3199739-3199761 CCGGAGAATCACAGCAGCTGCCA 0: 1
1: 0
2: 4
3: 31
4: 369
Right 968864574 4:3199767-3199789 CTGTTCCGCAGTGATGGCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 135
968864570_968864573 -1 Left 968864570 4:3199739-3199761 CCGGAGAATCACAGCAGCTGCCA 0: 1
1: 0
2: 4
3: 31
4: 369
Right 968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG 0: 1
1: 0
2: 0
3: 10
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968864570 Original CRISPR TGGCAGCTGCTGTGATTCTC CGG (reversed) Exonic
900766222 1:4507525-4507547 TGGCAGCTGCATTGTTTCTTTGG + Intergenic
900805873 1:4768086-4768108 TGGCACCTGCTGTAAACCTCTGG - Intronic
900892475 1:5459346-5459368 TGGAGTCTGCTGTGATTCTGAGG - Intergenic
900950538 1:5856018-5856040 TGGCAGCTGCTGCGACTGTCAGG - Intergenic
901798771 1:11695057-11695079 GTGCAGCTGCTGTGAGTCCCAGG - Intronic
902209611 1:14895198-14895220 TGGCTGCAGCTGAGATTCTGGGG - Intronic
902639958 1:17760774-17760796 TGCCAGCTGAGGTGATTGTCAGG - Intronic
903328006 1:22582335-22582357 TGGCCCCTGCTGTGGGTCTCAGG - Intronic
903337645 1:22635582-22635604 TGGCAGCTGCAGTGGTTCCCAGG + Intergenic
904833423 1:33320159-33320181 TGGCTGCAGCTGGGCTTCTCTGG + Intronic
904983090 1:34523142-34523164 TGGCAGCTGATGTGGCCCTCTGG - Intergenic
905328483 1:37175344-37175366 TCTCTGCTGCTGTGACTCTCGGG + Intergenic
907270888 1:53290477-53290499 TGGCAGCTACTGTTGTTTTCAGG + Intronic
907606031 1:55818341-55818363 TAGCATCTGCTGTGCTTCTGTGG + Intergenic
908766840 1:67561905-67561927 TGGCAGCTTCTGTGTGCCTCAGG + Intergenic
909116230 1:71540834-71540856 TGGCATCTGCTTGGATTCTAGGG + Intronic
909724657 1:78819730-78819752 TGGCATCTGCTGAGCTTCTGGGG - Intergenic
913293276 1:117294940-117294962 TGGCAGCTGCCAGGATTCTTTGG - Intergenic
913573307 1:120143062-120143084 TGGTAGCTGCTGTGAGGCTGCGG - Intergenic
915107087 1:153541401-153541423 TGCCTGCTGCTTGGATTCTCTGG - Exonic
915567968 1:156727125-156727147 TGGCAACTTCTGGGATGCTCCGG + Exonic
915734142 1:158074130-158074152 TGGCAGGTGCTGAGATCCTGGGG - Intronic
916650412 1:166829839-166829861 TGCCTCCTGCTGTGATTCTGAGG + Intergenic
917447719 1:175120750-175120772 TAGCAGCTGCTGTGTTGGTCAGG - Intronic
917516493 1:175712785-175712807 TGGCATCTGCTCAGTTTCTCGGG - Intronic
917704657 1:177619947-177619969 GGTCAGCTGCTCTGTTTCTCAGG - Intergenic
917968157 1:180191463-180191485 TGGCAGTTCCTCTGATTCACGGG - Intronic
919086561 1:192927744-192927766 TTGCAGCTGCTGTGAGTGTCTGG - Intergenic
919283108 1:195517878-195517900 TGGCAGCTGCTTGGCTTCTGGGG - Intergenic
919983724 1:202658519-202658541 TGGCAGCTGCTGTCATAGCCTGG - Intronic
920446284 1:206021149-206021171 TGGAACCTGCTGTGCGTCTCTGG + Exonic
922798281 1:228352208-228352230 TGGCTGCTGCTGTGAGCCTGTGG + Intronic
923708302 1:236363787-236363809 TGGCATCTGCTGGGCTTCTAGGG - Intronic
1063092513 10:2879729-2879751 TGGCAGGTCCTGGGATTCTGGGG + Intergenic
1063173905 10:3534728-3534750 TGGGAGCTGCTGCGACTCTGCGG - Intergenic
1063418553 10:5892054-5892076 CCGCAGCTCCTGTGATTTTCTGG + Intronic
1065106767 10:22396399-22396421 TGCCTCCTGCTGTGATTCTGAGG + Intronic
1065122569 10:22543656-22543678 TGGCAGCTGCCGAGATTCTAGGG - Intronic
1065692144 10:28345467-28345489 TGGCATCTGCTCTGCTTCTGGGG - Intergenic
1066549051 10:36534941-36534963 TGGAAACTGCTGAGATGCTCTGG + Intergenic
1067089624 10:43259959-43259981 TAGCAGGTGGTGTGGTTCTCTGG - Intronic
1067791082 10:49288263-49288285 TGGCACCAGCTGTTATTCACTGG + Intergenic
1068062972 10:52092477-52092499 TGGAAGCTGCTGATATTCTTTGG + Intronic
1068087931 10:52398225-52398247 AGGCAGTAGCTGTGTTTCTCTGG + Intergenic
1068175346 10:53449620-53449642 TGGCATCTGCTCTGCTTCTTGGG + Intergenic
1068212064 10:53933058-53933080 TGGCATCTGCTCTGGTTCTATGG - Intronic
1068224410 10:54088012-54088034 TGGCACCTGCTCTGCTTCTGGGG - Intronic
1068581626 10:58747036-58747058 TGTCAGCTGCTGAGGTTCACGGG + Intronic
1070517196 10:77219112-77219134 TGGCTGCTGTGCTGATTCTCTGG - Intronic
1071083515 10:81840829-81840851 TGGCAGCAGCTTTCTTTCTCAGG + Intergenic
1072716171 10:97754036-97754058 TGGGAGCTGCTGTGCTCCTGAGG + Intronic
1072741177 10:97910867-97910889 TGGCAGCTAATGAGATTATCTGG - Intronic
1072893461 10:99345553-99345575 TGGCAGATGGTGTCATTCTCAGG - Intronic
1073136978 10:101225595-101225617 TGGGAGCTGGTGTGAATTTCTGG - Intergenic
1074008562 10:109454069-109454091 TGGGTGCTGCTGTGATAGTCAGG - Intergenic
1074116028 10:110458052-110458074 TGGCAGCAGGTGGGCTTCTCCGG + Intergenic
1074319827 10:112391853-112391875 GGGCACCTGCTGTCAATCTCAGG - Intronic
1075223125 10:120601537-120601559 GTGCATCTGCTGTGATTCTTGGG + Intergenic
1076086860 10:127640008-127640030 TTGTAGCTGCCGTAATTCTCAGG + Intergenic
1076161678 10:128248382-128248404 GGTCACCTTCTGTGATTCTCAGG - Intergenic
1076333884 10:129692082-129692104 TGGCAGCTGCCATGATTTTTGGG + Intronic
1078360281 11:10662673-10662695 TGTCTGCTGCTGTGGTACTCTGG + Intronic
1078462690 11:11526856-11526878 TGACAGCTGCTGTGCTCCTGCGG - Intronic
1081906529 11:46673832-46673854 TGGCAGCAGCTGTGCTTCAGTGG + Intronic
1081985049 11:47295656-47295678 TGGAGGCTGCTCTGAGTCTCAGG + Intronic
1083235174 11:61346454-61346476 TGGCAGCTGCTGCCATCCTCCGG + Exonic
1084639469 11:70415960-70415982 TGGCATCTGCTGTCATTGTGGGG + Intronic
1085241809 11:75062731-75062753 TGGCATCTGCTTGGCTTCTCGGG - Intergenic
1089305460 11:117523679-117523701 TGGGCTCTGCTGTGGTTCTCTGG + Intronic
1089713085 11:120331131-120331153 TGCCAGGTTCTGTAATTCTCTGG + Intronic
1090009524 11:123033970-123033992 TGGCACTTCCTTTGATTCTCTGG - Intergenic
1090343848 11:126051145-126051167 TGGCTGCTGCTCTGATTCCATGG + Intronic
1090834091 11:130441290-130441312 TGGCATCTGCTCTGCTTCTGGGG + Intergenic
1091434992 12:465383-465405 TGGCAGATACTGTGTTTATCAGG + Intronic
1091675453 12:2485855-2485877 TGGCAGCTGCTGTACTTCCAAGG - Intronic
1093371780 12:18374916-18374938 TGGCATCTGCTGGGCTTCTGGGG - Intronic
1094199121 12:27779791-27779813 TGGGGGCTGCAGTGATGCTCCGG - Intergenic
1094240076 12:28212286-28212308 TTGAATCTGCTGTGATTCTGGGG - Intronic
1095199183 12:39362148-39362170 TGGCAGCTGCTTGGCTTCTAGGG - Intronic
1095469195 12:42518532-42518554 TGGCAGCTGTTGTTAGTGTCAGG - Intronic
1095639366 12:44468980-44469002 TGGCATCTGCTGGGCTTCTGGGG - Intergenic
1095641813 12:44494581-44494603 TGGCATCTGCTGGGCTTCTAGGG + Intergenic
1096178085 12:49536314-49536336 TGTAAGCTGCTGTAATCCTCAGG + Intergenic
1096511288 12:52130887-52130909 TGGCTCCTGCTGTGAGTCTCAGG + Intergenic
1096795141 12:54072179-54072201 TGGCAGCCTCTGTGATTTTTTGG - Intergenic
1097330202 12:58324640-58324662 TTGAATCTGCTGTGATTCTGGGG + Intergenic
1098432020 12:70429981-70430003 AGACAGCTGGTGTAATTCTCAGG - Intronic
1098954083 12:76670498-76670520 AAGAAGCTGCTGTGATACTCTGG + Intergenic
1099165997 12:79307860-79307882 TGGCAGCTGCTGTGATTACCTGG + Intronic
1100614810 12:96222856-96222878 TGGCATCTGCTGGGTTTCTGGGG + Intronic
1100921232 12:99489902-99489924 TGGCAACTGCAGTTTTTCTCTGG + Intronic
1101002252 12:100368256-100368278 TGGTAGCTGCTGGGAATCCCAGG + Intronic
1101483488 12:105127185-105127207 TGGCAGCTGCTGGTATTTTCTGG - Exonic
1103722975 12:122984337-122984359 TGACAGGGGCTGTGATTGTCGGG + Exonic
1103870275 12:124086277-124086299 TGACAGCTGCTGTGGTTATTTGG + Intronic
1104897608 12:132172023-132172045 GGCCAGCTGCTGTGCCTCTCTGG - Intergenic
1105242178 13:18618812-18618834 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1105659859 13:22482004-22482026 TGGCATCTGCTGAGCTTCTGGGG - Intergenic
1108183541 13:47865854-47865876 TGGCGGGAGGTGTGATTCTCAGG + Intergenic
1108447832 13:50527067-50527089 TGGCTGCTGCTGTCAAACTCAGG - Intronic
1109185072 13:59258777-59258799 TGGCAGCTGTTGTTCTTCTAAGG - Intergenic
1109589953 13:64464904-64464926 TGGCAGCTGGTTTGTTTCTGGGG + Intergenic
1110550718 13:76808345-76808367 TGGCATCTGCTGAGCTTCTGGGG - Intergenic
1111927731 13:94481054-94481076 TGGCAGCTGCTGTCAATCCTTGG + Intergenic
1111937450 13:94571466-94571488 TGGCAGCTGCTGTGCTTATGTGG + Intergenic
1113282858 13:108809444-108809466 TGGCATCTGCTGGGCTTCTGGGG + Intronic
1113968333 13:114167503-114167525 TTGAATCTGCTGTGATTCTGGGG - Intergenic
1113968896 13:114173292-114173314 TCGGATCTGCTGTGATTCTGGGG - Intergenic
1115121262 14:29940796-29940818 TGGCATCTGCTTGGATTCTGCGG - Intronic
1117056507 14:51917266-51917288 TGGCAGCGGCTGGGATTCACTGG - Intronic
1117610898 14:57482348-57482370 TGTCAGCTGATGTGAACCTCAGG + Intronic
1117828712 14:59729188-59729210 TGGGAGCTGCACTGATTCCCAGG + Intronic
1118501423 14:66365939-66365961 GGGCAGGGGCTGTGACTCTCAGG - Intergenic
1118887413 14:69878837-69878859 GGGCAGCCGCTGTGAGACTCAGG + Intronic
1119729460 14:76941851-76941873 TGGCAGCTGCTGCTGTTCTGGGG + Intergenic
1119769853 14:77213697-77213719 TGGCTGCTACTCTGATGCTCTGG + Intronic
1120717019 14:87851159-87851181 TGTCAGCTTCTCTGGTTCTCAGG - Intronic
1120810459 14:88798218-88798240 TGGCAGCTGTTTTGCTTGTCTGG - Intergenic
1122231875 14:100310213-100310235 TGGCAGCTCCTCTGAGTCCCTGG + Intergenic
1122882803 14:104697592-104697614 GGGCAGCTGCACTGACTCTCGGG - Intronic
1123006618 14:105326828-105326850 TGGGAGCTGCTGTGGTGCCCTGG + Intronic
1123146145 14:106132406-106132428 TTGAATCTGCTGTGATTCTGGGG + Intergenic
1123489137 15:20765785-20765807 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1123545636 15:21334872-21334894 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1124202135 15:27687453-27687475 GGGCATCTGCAGGGATTCTCTGG - Intergenic
1124440947 15:29685886-29685908 TGGCAGCTGCTCCTGTTCTCAGG - Intergenic
1125242752 15:37595159-37595181 ATGCAGTTGCTTTGATTCTCAGG + Intergenic
1125274658 15:37978089-37978111 TGGCAGTGGCTGTGTTTCTCTGG - Intergenic
1127053960 15:55113270-55113292 TGGCAGGTGCTGTGATGCAATGG + Intergenic
1127623736 15:60759722-60759744 TGGCAGCTCCTGAGATCCACAGG - Intronic
1128214784 15:65926850-65926872 TGGCTCCTGCTGAGATTCTAGGG + Intronic
1128447320 15:67775399-67775421 TTTCAGCTGCTGTGGTTTTCTGG + Intronic
1129034088 15:72639418-72639440 TGGCATCAGCTGTGAGTTTCAGG - Intergenic
1129062897 15:72874354-72874376 TGCCAGTTGCTTAGATTCTCTGG + Intergenic
1129215794 15:74097798-74097820 TGGCATCAGCTGTGAGTTTCAGG + Intergenic
1129219854 15:74125615-74125637 TGGCAGCTCATGTAATTATCTGG - Intronic
1130103419 15:80911495-80911517 TGGAAGCTGTTGTGAATCTCAGG + Intronic
1132142623 15:99407916-99407938 CAGCAGCTTCTGTGGTTCTCTGG - Intergenic
1132264914 15:100461322-100461344 TGGCAGCTTCTTTCATTCTGAGG - Intronic
1202953978 15_KI270727v1_random:62142-62164 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1132589196 16:719044-719066 TGGCACTTGCCCTGATTCTCTGG + Exonic
1136408648 16:30064298-30064320 TGGTGGCTGTTCTGATTCTCTGG - Intronic
1138289936 16:55838137-55838159 TGGCAACTGCTGTGGTAGTCAGG + Intergenic
1138292047 16:55856101-55856123 TGGCATCTGCTCAGCTTCTCGGG - Intronic
1138325371 16:56161491-56161513 TTGAATCTGCTGTGATTCTGGGG + Intergenic
1139922270 16:70467749-70467771 TGGCAGTTGCTGGCATTCTCAGG - Intronic
1140343470 16:74188625-74188647 TGGCATCTGCTGGGCTTCTGGGG - Intergenic
1140477757 16:75247448-75247470 TCCCAGCCGCTGTGCTTCTCAGG - Intronic
1140910783 16:79449876-79449898 TAGCCGCTGCTGAAATTCTCTGG - Intergenic
1141208989 16:81958738-81958760 TGCCAGCTGCTGGGAGGCTCTGG + Exonic
1141775332 16:86119145-86119167 TGGCAGCTGCTGTGTGACCCTGG - Intergenic
1144196703 17:12901655-12901677 TGGGAGCTGCTGTGATCACCTGG + Intronic
1144712989 17:17414590-17414612 TGGCAGCTGCTGTGTTCCCGAGG + Intergenic
1146547721 17:33753555-33753577 CTGAAGCTGCTGTGATTCTAGGG - Intronic
1146991983 17:37282318-37282340 TGGCATCTGCTCTGCTTCTGGGG - Intronic
1147475823 17:40710660-40710682 TGGCATCTGCTTTGCTTCTGGGG + Intergenic
1148437240 17:47694184-47694206 CGGCAGCAGCTGTGAGTCCCCGG + Intronic
1148798532 17:50209352-50209374 TGGCAGCTACTTTCCTTCTCTGG - Intergenic
1149308261 17:55370103-55370125 TAGCAACTGTTGTCATTCTCTGG + Intergenic
1150842650 17:68623219-68623241 TGACAGCTGCTGTGAAACTCTGG - Intergenic
1151301949 17:73232933-73232955 TGCCAGCTGTTCTGATTCTGCGG - Intronic
1151961836 17:77409659-77409681 TGGCAGCTGCTCTGACTTCCTGG - Intronic
1152005803 17:77679889-77679911 TGGCAGCTGCCTGGTTTCTCAGG + Intergenic
1152588301 17:81198892-81198914 TGGAGGCTGCTGTGGTTCTGGGG + Exonic
1153500527 18:5744816-5744838 TGTCAGCTGCTGAGAGTCTGAGG - Intergenic
1154446772 18:14441068-14441090 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1155946441 18:31857629-31857651 TGGCAGCTGCACTGAGGCTCCGG + Exonic
1156499809 18:37550598-37550620 TGGCAGCCTCTGTGATCCGCAGG + Intronic
1156741327 18:40332596-40332618 TGGCATCTGCTTTGCTTCTAGGG - Intergenic
1156969131 18:43133787-43133809 TGCCTCCTGCTGTGATTCTGAGG + Intergenic
1157478109 18:48036258-48036280 TGCCTGCTGCTGTCATTCTGTGG - Intronic
1157882794 18:51337476-51337498 TAGCAGCTTCTTTTATTCTCTGG + Intergenic
1157957214 18:52111908-52111930 TGGCATCTGCTGGGCTTCTTGGG + Intergenic
1158362443 18:56690248-56690270 TAACATCTGCGGTGATTCTCAGG + Intronic
1160255370 18:77243720-77243742 AGGCAGCTGCTCTGGGTCTCTGG - Intergenic
1160603011 18:80028751-80028773 TGACAGCTGCTATGCTTCTAGGG + Intronic
1161634368 19:5377904-5377926 TTGCAGCTGCAGTGACTCTGGGG - Intergenic
1163629542 19:18410735-18410757 CGGGACCTGCTGGGATTCTCAGG + Intergenic
1166132890 19:40757188-40757210 TGGCTGCTTCTGTGATTGTTAGG + Intronic
1166426247 19:42680944-42680966 TGGCACCTGCTCTGCTTCTGAGG - Intronic
928302588 2:30139419-30139441 TTGAATCTGCTGTGATTCTGGGG + Intergenic
929012301 2:37456970-37456992 GGGCATATGCTGTGATTCCCAGG + Intergenic
929540399 2:42814981-42815003 TGCCAGCTGCCTTGATTCACTGG + Intergenic
930005330 2:46892063-46892085 TGCCTGCCGCTGTGCTTCTCAGG + Intergenic
930104096 2:47626657-47626679 TAGCATCTGCTGGGATTCTGGGG - Intergenic
930469302 2:51792805-51792827 TGGCATCTGCTCTGCTTCTGGGG + Intergenic
931879543 2:66554030-66554052 AGGCAGTTGCTGAGCTTCTCAGG + Intronic
933402591 2:81818320-81818342 TGGCATCTGCTCTGCTTCTAGGG + Intergenic
934605019 2:95688112-95688134 TGGCTGTTGCTCTCATTCTCAGG + Intergenic
937470025 2:122166706-122166728 TGGGAGATGCTGTGCTTCCCTGG - Intergenic
937684844 2:124684175-124684197 TGACAGCAGCTGTCATTCTGTGG + Intronic
938532965 2:132208431-132208453 TGGTAGCTGCTATTTTTCTCTGG + Intronic
939326009 2:140689436-140689458 TTGAATCTGCTGTGATTCTGGGG + Intronic
939473793 2:142659320-142659342 AGGCAGCTCCTCTGTTTCTCTGG + Intergenic
940249669 2:151661075-151661097 TGGGAGGTGCTTTGCTTCTCTGG + Intronic
941261952 2:163307997-163308019 TGGCATCTGCTGGGCTTCTGGGG - Intergenic
941378904 2:164766554-164766576 TGGCATCTGCTCAGATTCTAGGG - Intronic
941384055 2:164831691-164831713 TGGCAGCTCCCATAATTCTCAGG - Intronic
941721235 2:168815301-168815323 TAGGAGCTGCTATGTTTCTCTGG - Intronic
942237562 2:173926976-173926998 TGGCATCTGCTCTGCTTCTGGGG + Intronic
942358464 2:175145480-175145502 TGGCATCTGCTCAGCTTCTCAGG - Intronic
943000254 2:182318650-182318672 TGGCAGCAGCTGTGGTCCTGTGG - Intronic
943557662 2:189425895-189425917 TGGCATCTGCTCAGATTCTGGGG - Intergenic
944828597 2:203509952-203509974 TGGCATCTGCTCTGCTTCTGGGG - Intronic
945570539 2:211462105-211462127 TGGCATCTGCTTGGCTTCTCGGG + Intronic
946127314 2:217574295-217574317 TGGCAGGTGCAGTGGTCCTCTGG - Intronic
946351471 2:219157541-219157563 TGGCAGATGCACTGATTCTACGG - Exonic
946433590 2:219638273-219638295 TGGCAGCTGCTGTCACCCCCAGG + Intronic
946789159 2:223283104-223283126 TGGCAGCTCCAGAGAATCTCTGG - Intergenic
946888383 2:224247343-224247365 TTGAATCTGCTGTGATTCTGGGG - Intergenic
947416096 2:229897886-229897908 TGGCAGGTGTTGTGACTATCTGG - Intronic
947721818 2:232374354-232374376 TGGCAGCTGATGTGAGACTTTGG + Intergenic
947806741 2:232973956-232973978 TGGCAGCTGCTGTGCCTCCCGGG + Intronic
948808960 2:240465362-240465384 TGGAAGCTGCTGGGCATCTCAGG + Intronic
1168875447 20:1169018-1169040 AGGCAGCTGCTGTGTGGCTCTGG + Intronic
1168875543 20:1169660-1169682 AGGCAGCTGCTGTGTGGCTCTGG - Intronic
1170338890 20:15301186-15301208 TGGCAGCTGTTGCTATTCTAGGG + Intronic
1170527769 20:17258170-17258192 TCACAGCTGCTGTGATTGTGAGG + Intronic
1172213040 20:33214383-33214405 AGGCAGCCGCTGGGTTTCTCTGG + Intergenic
1172302238 20:33858292-33858314 TTGCAGCAGCTGTGATCCTGTGG + Intergenic
1173468781 20:43306156-43306178 TGGCATCTGCTGAGCTTCTCAGG + Intergenic
1174086060 20:48008111-48008133 TGGCATCTGCTGGGCTTCTGGGG + Intergenic
1175769293 20:61613266-61613288 AGGCAGCAGCTGTGTCTCTCTGG - Intronic
1176197692 20:63844895-63844917 TGGCATCTGCTGTGATTTCAGGG - Intergenic
1176449202 21:6848772-6848794 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1176827370 21:13713796-13713818 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1177425085 21:20912475-20912497 TGGCATCTGCTGGGATTCTGAGG + Intergenic
1177653450 21:23986515-23986537 TGCCTTCTGCTGTGATTCTGAGG + Intergenic
1177762228 21:25414916-25414938 TGGCATCTGCTGGGCTTCTGGGG + Intergenic
1178353693 21:31892890-31892912 TGGCAGCTTCTGTGGTTCCTTGG + Intronic
1178762905 21:35421218-35421240 TGGCAGCTGCTCGGCTTCTGGGG + Intronic
1179085082 21:38209094-38209116 AGGCAGGTGCTGTGAGGCTCAGG - Intronic
1179567583 21:42258742-42258764 TGGCAGCTGCTGTAAGACTCGGG + Intronic
1180204350 21:46248346-46248368 GGGGAGCTGCTGGTATTCTCAGG - Intronic
1180367769 22:11956553-11956575 CCGAATCTGCTGTGATTCTCGGG + Intergenic
1182352252 22:29705547-29705569 TGGGAGCTGCTGGCATTCACTGG - Intergenic
1183095127 22:35547382-35547404 TGGCTGCTGCTTTCCTTCTCCGG + Intronic
1183979664 22:41532102-41532124 TGGCTGCTGCAGTGACTCTGGGG + Exonic
1184749678 22:46478104-46478126 TGGTACCTGCTGAGAGTCTCAGG - Intronic
1185026503 22:48417259-48417281 AGGCAGCTGCTGTGACTCTTGGG + Intergenic
950145354 3:10646018-10646040 TGGCAGCTGCTGTCTATCACAGG + Intronic
950493878 3:13322273-13322295 TGGCAGCTGATGAGGGTCTCTGG + Exonic
951413235 3:22390899-22390921 AGGCAGCTGCTTTTATTTTCAGG - Intergenic
952553451 3:34504879-34504901 TGGCAGCTGTTTTTCTTCTCCGG + Intergenic
953324648 3:42002816-42002838 TGGCAGCTGCTGGCATTCCTTGG + Intergenic
953883543 3:46703447-46703469 TGGCAGCTGCCCTAATTCTAAGG - Intronic
954192580 3:48974479-48974501 TGGCAGCTCCTGTGCTTCTTTGG + Intronic
954625971 3:52022106-52022128 GGGGAGCTCCTGTGATTCCCAGG + Intergenic
955423945 3:58768165-58768187 GGCCAGCTGCTGTGCTTCCCTGG + Intronic
956106345 3:65822646-65822668 TGGCATCTGCTGGGCTTCTGGGG + Intronic
959301485 3:104607812-104607834 TGGCATCTGCTTGGCTTCTCGGG - Intergenic
959737807 3:109680532-109680554 TGGAAGTTGCTGCAATTCTCTGG - Intergenic
961397660 3:126607798-126607820 TGACAGCTGCTCTGTTACTCAGG - Exonic
963204626 3:142620058-142620080 TTCCAGTTGCTGTCATTCTCAGG + Intronic
964176719 3:153832480-153832502 TGGCATCTGCTCTGCTTCTGGGG + Intergenic
965182778 3:165426084-165426106 AGACAGCAGCTGTGAATCTCTGG + Intergenic
965693155 3:171379428-171379450 TGTCAGCTGCTGGGATTCACTGG + Intronic
966272193 3:178120819-178120841 TGGCATCTGCTTTGCTTCTGGGG - Intergenic
966984198 3:185164778-185164800 TGACAGCTGTTGTGATTTCCAGG + Intergenic
967289189 3:187902498-187902520 TGCCAAATGCTGTGATTCCCAGG - Intergenic
968026028 3:195443080-195443102 TGGCCGCTGCTGTCACTCCCCGG - Intergenic
968545671 4:1196522-1196544 TGGCCTCTGCTCTGAGTCTCGGG - Intronic
968691325 4:1991897-1991919 TGGCAGAGGCTGTGCTGCTCAGG - Intronic
968864570 4:3199739-3199761 TGGCAGCTGCTGTGATTCTCCGG - Exonic
969485548 4:7470571-7470593 CGGTAGCTGCTGTGATGGTCTGG + Intronic
970070036 4:12147949-12147971 TGGCATCTGCTCTGAATCTGGGG + Intergenic
970816034 4:20156981-20157003 TGACATCTGCTGTGATTGTGAGG - Intergenic
970855942 4:20649544-20649566 TGGCACCTGCTCAGCTTCTCAGG - Intergenic
971121324 4:23708114-23708136 TGGAAGTTGCTGTGACTTTCTGG - Intergenic
972149403 4:36070024-36070046 TGGCATCTGCTTGGCTTCTCGGG - Intronic
972378390 4:38495387-38495409 TGTAAGCTGCAGTGATTCTGGGG - Intergenic
974047702 4:56910815-56910837 TGGCAGCTGCTGTGATTACCTGG + Exonic
975902350 4:79167725-79167747 TGGCATCTGCTTAGCTTCTCAGG + Intergenic
976798397 4:88959567-88959589 TGGCATCAGCTGGGCTTCTCGGG - Intronic
977541037 4:98318966-98318988 GGGCAACTGCTGTAGTTCTCTGG + Intronic
977979629 4:103306985-103307007 TGGCAGCGGCTCTGTTTCTCTGG - Intergenic
978418334 4:108502887-108502909 TGGTAACTGCTGTTATTATCTGG - Intergenic
979662407 4:123272507-123272529 TAGCAGTTTCTATGATTCTCAGG + Intronic
979827272 4:125254967-125254989 AGGCAGTTGCTCTGATTTTCTGG + Intergenic
980406616 4:132361139-132361161 AGGCATCTGCTGTGCTTCTAGGG - Intergenic
980967134 4:139533041-139533063 TGTCAGCTGTGGTGACTCTCAGG + Intronic
981601236 4:146491363-146491385 AGTCAGCTCCTTTGATTCTCTGG - Intronic
982171070 4:152662456-152662478 TGGCTGCTGATCTGATTCTATGG - Intronic
983929787 4:173440804-173440826 TGGTAGCTGCTGAGAATCTCTGG + Intergenic
984436292 4:179714101-179714123 TGGCATCTGCTGGGCTTCTGGGG - Intergenic
985084241 4:186296694-186296716 TGGCAGCTGCTGGGGTTCAGAGG - Intergenic
985517785 5:355794-355816 CCGCAGCTGCAGTGACTCTCAGG + Intronic
985931935 5:3065169-3065191 TGGCAGCTGCTGTCATCAGCAGG - Intergenic
986096186 5:4556024-4556046 TGTCAGCGGCTGTGACACTCGGG - Intergenic
986104251 5:4644632-4644654 TGGAATCTGCTGTGATTCTGGGG - Intergenic
986348851 5:6858653-6858675 TGGCAGCTGCTGCAAGTATCAGG - Intergenic
986892828 5:12330081-12330103 TGACAGCTGATGTGATACTTTGG + Intergenic
987627354 5:20419224-20419246 TGTCTGCTGCTATGATTCTGAGG + Intronic
988605203 5:32673347-32673369 TGGCACCTGCTGTGATTGATTGG - Intergenic
988866350 5:35339203-35339225 TGGCAGCTGCTGGCATTCCTTGG - Intergenic
989200031 5:38754037-38754059 TGTCAGCTCCTTTTATTCTCTGG - Intergenic
990792562 5:59497301-59497323 TGGGAGCTAGTGAGATTCTCTGG - Intronic
991251425 5:64566235-64566257 TGACAGCTGATGTGATACCCTGG + Intronic
992719609 5:79547595-79547617 CGGCTGCTTCTGTGGTTCTCTGG - Intergenic
993248915 5:85489015-85489037 TTGAATCTGCTGTGATTCTGGGG + Intergenic
993502432 5:88678577-88678599 CCGCTGCTGCTGTGATTCGCAGG - Intergenic
993760967 5:91796714-91796736 TGGCATCTCCCGTGATTCTCAGG - Intergenic
994789504 5:104205961-104205983 TGGCCCCTGCTGTGACTGTCTGG - Intergenic
995547292 5:113245818-113245840 TGGCAGTTGCTGTGATTGAATGG - Intronic
996183226 5:120446258-120446280 TTCCAGCTGCTGTTAATCTCTGG - Intergenic
996834211 5:127772938-127772960 TGGCAGCTTCTGTTTTTTTCAGG + Intergenic
997413337 5:133706880-133706902 TAGCAGCTTCCATGATTCTCTGG + Intergenic
997648246 5:135495670-135495692 TGCCTCCTGCTGTGATTCTTAGG - Intergenic
998139044 5:139689747-139689769 AGGCAGCTGCTGGGAGTCTTGGG + Intergenic
1000664955 5:163983664-163983686 TGGCAGCTGCTTTTTTTCCCCGG + Intergenic
1002430979 5:179203604-179203626 TGGCAGCTGCTGTGCTGAACAGG - Intronic
1002957193 6:1877728-1877750 TGGCAGCTGCGTTGTTTCTCTGG + Intronic
1002983266 6:2163239-2163261 TGTCATCTGCCTTGATTCTCAGG + Intronic
1003213242 6:4086809-4086831 TGGCAGCTTCTGTCTTGCTCTGG + Intronic
1003375384 6:5572195-5572217 TGGCATCTGCTTGGCTTCTCAGG + Intronic
1003977848 6:11360675-11360697 TGGCAGCTGCTCAGCTTCTGGGG - Intronic
1004461672 6:15842447-15842469 TGTCAGCTCTTCTGATTCTCAGG - Intergenic
1005051509 6:21688057-21688079 TGGTGGCTGCTGGCATTCTCTGG - Intergenic
1005253313 6:23972384-23972406 TGGCAACTTCTGGGATGCTCTGG - Intergenic
1005423197 6:25673878-25673900 TGGCATCTGCTTTGCTTCTGAGG + Intronic
1006219237 6:32474098-32474120 TGGAAAATGCTGTGATTCTGTGG + Intergenic
1007416692 6:41695165-41695187 AGGCAGGTGCTGTGATTAGCAGG - Intronic
1007506908 6:42342544-42342566 CTGGAGCTTCTGTGATTCTCAGG - Intronic
1007901993 6:45421781-45421803 CGGCAGCGGCTGCGATTCGCAGG + Intronic
1010360321 6:74986167-74986189 TGGCATCTGCTTTGCTTCTGGGG - Intergenic
1011264478 6:85500617-85500639 TGGCATCTGCTTTGCTTCTGGGG - Intergenic
1013608220 6:111770692-111770714 TGGCATCTGCTCAGCTTCTCAGG + Intronic
1013760292 6:113510360-113510382 TGGCATCTGCTCTGTTTCTAGGG - Intergenic
1013827478 6:114231380-114231402 TGGCATCTGCTGGGCTTCTAGGG - Intronic
1015626396 6:135183316-135183338 TGGCCGCTACTGTGATTCGGAGG - Intronic
1018236168 6:161725823-161725845 TGGCACATGCTGTGATTCTCAGG + Intronic
1018425217 6:163673860-163673882 TGGCACCTGCTCTGCTTCTGGGG + Intergenic
1019295899 7:274529-274551 TTGAATCTGCTGTGATTCTGGGG + Intergenic
1021613877 7:22482703-22482725 TTCCAGCTGCTCTCATTCTCTGG - Intronic
1021625609 7:22590085-22590107 CCGCTGCTGCTGTGATTTTCTGG + Intronic
1021768752 7:23977219-23977241 TTGAATCTGCTGTGATTCTGGGG - Intergenic
1021982781 7:26071019-26071041 TGTGAGCTGCTGTGAATGTCAGG + Intergenic
1022409748 7:30130041-30130063 CAGAAGCTGCTGTGATTCTATGG - Intronic
1022981885 7:35611798-35611820 TGGCATCTGCTTGGCTTCTCAGG - Intergenic
1024661384 7:51498546-51498568 AGGCAGTTGCTGGGATCCTCAGG - Intergenic
1027395367 7:77747892-77747914 TGGCATCTGCTCAGCTTCTCGGG + Intronic
1027421578 7:78022035-78022057 TTCCAGGTGCTGTGATTCCCAGG + Intronic
1027568837 7:79835477-79835499 TGGCATCTGCTGTGGTGATCTGG - Intergenic
1029934953 7:104414322-104414344 TTGCAGCTGATGAGATTTTCAGG + Intronic
1030953747 7:115825069-115825091 TGGCATCTGCTCTGCTTCTAGGG + Intergenic
1031530054 7:122865232-122865254 TGGCAACTGGTGAGAGTCTCAGG - Intronic
1032764726 7:134980213-134980235 TTGCAGATGATGTGATTCTATGG + Intergenic
1032907473 7:136387067-136387089 AGGCAGCTGCTGTGCTTAGCTGG - Intergenic
1034488000 7:151378212-151378234 TGGCTGCTGCTGTGGTCCTGGGG - Exonic
1034636458 7:152571214-152571236 TGGGAGCTGCTGGGAGTCTCAGG + Intergenic
1034728978 7:153366897-153366919 TGGCATCTGCTTGGATTCTGGGG + Intergenic
1034848337 7:154469419-154469441 TGGCAGCAGCTGTGAGTCAGGGG - Intronic
1035059848 7:156061506-156061528 TGGCAGCTGCTATTAATCTGTGG + Intergenic
1036249125 8:7146620-7146642 TGTCAGCTGCTTTCATTCTATGG + Intergenic
1036418509 8:8573344-8573366 TGGCATCTGCTGGGTTTCTGGGG - Intergenic
1036674166 8:10816031-10816053 TGTCGGCAGCTGTGATTGTCAGG + Intronic
1036974648 8:13397228-13397250 TGGAAGCTGTGGTGATTCCCAGG + Intronic
1037452532 8:19030627-19030649 TGGCAGCTGCTTGGCTTCTAGGG - Intronic
1037579200 8:20234755-20234777 TGCCAGCTGCTCTCGTTCTCTGG - Intergenic
1038347456 8:26745364-26745386 GGGCAGCTGGGGTGGTTCTCTGG + Intergenic
1039826433 8:41178043-41178065 TGCCAGCTGGTTTGATTGTCTGG + Intergenic
1040535318 8:48304010-48304032 TGGCATCTGCTGGGCTTCTGTGG - Intergenic
1042003324 8:64151825-64151847 TTGCAGCAGCTGTTATTTTCTGG - Intergenic
1043711335 8:83422578-83422600 TGCCAGATGCTGTGGTTCTGAGG + Intergenic
1044731438 8:95231689-95231711 TGACAGCTTCTGTGGTTGTCAGG + Intergenic
1045044187 8:98258833-98258855 TTGAATCTGCTGTGATTCTGGGG + Intronic
1046133999 8:110003462-110003484 TGGCATCTGCTGGGCTTCTGAGG + Intergenic
1047851872 8:128865780-128865802 TGGCACCTGCTTGGATTCTAGGG - Intergenic
1047888741 8:129283034-129283056 TGGCATCTGCTGGGCTTCTGGGG + Intergenic
1048191049 8:132289454-132289476 TGGTAGCTGCTGGCATTCTTTGG + Intronic
1048557979 8:135500111-135500133 CAGCAGCTGCAGTGATTTTCTGG - Intronic
1049392186 8:142377601-142377623 TGGCAGGTGCTGGCATCCTCTGG - Intronic
1049510168 8:143023224-143023246 TGGCAGCTGATGTGAATAGCCGG + Intronic
1049517432 8:143068506-143068528 TGGCATCTGCTTGGCTTCTCGGG - Intergenic
1049689267 8:143951651-143951673 TGGCAGCGGCTGGGAATCTCTGG - Intronic
1051189102 9:14492475-14492497 TGGCATCTGCTCTGCTTCTGGGG + Intergenic
1051505364 9:17821289-17821311 TTGAATCTGCTGTGATTCTGGGG - Intergenic
1051565126 9:18488779-18488801 TGTCAGCTGCTGTGAATCCAGGG - Intronic
1053293350 9:36896591-36896613 TGGCACCTGATCTGCTTCTCAGG - Intronic
1054793893 9:69280744-69280766 TGGCAGCTGCTCTGCTTCTCTGG + Intergenic
1055207029 9:73744524-73744546 TGGCATCTGCTTGGTTTCTCAGG + Intergenic
1055781594 9:79827331-79827353 AGGCAGCTGCTGTGTGCCTCTGG + Intergenic
1056333613 9:85543292-85543314 TCACAACTCCTGTGATTCTCAGG + Intergenic
1056626707 9:88259622-88259644 TGACAGCTGCACTGTTTCTCAGG - Intergenic
1059699795 9:116764138-116764160 TGGCAGAGGCTGTGATGCTCCGG + Intronic
1059751696 9:117253672-117253694 CGGCAACTGCTGTAATTCTCTGG - Intronic
1060223202 9:121775094-121775116 TGGCAGCTGCTCTGGATCTGGGG + Intronic
1061625059 9:131836697-131836719 GGGCAGGTGCGGTGATCCTCAGG - Intergenic
1062407132 9:136402227-136402249 TGGCTGCTGCTGTCCTCCTCCGG - Exonic
1203519986 Un_GL000213v1:35744-35766 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1186704106 X:12123871-12123893 TGTCTGCTCCTGTGATTCCCAGG - Intergenic
1187561230 X:20405597-20405619 TGGCAGATGCTGGGAGCCTCTGG + Intergenic
1188650943 X:32631591-32631613 TGGCATCTGCTCTGCTTCTGCGG + Intronic
1189054775 X:37687109-37687131 TGGCAGCTGAGGTGTCTCTCTGG - Intronic
1189187107 X:39063972-39063994 TGGCAGATGCTGTGATGTCCAGG - Intergenic
1190446063 X:50525708-50525730 TGGCACCTGCTTGGCTTCTCAGG + Intergenic
1190705061 X:53020649-53020671 TGGCAGATGCTGTGATTAAAGGG + Intergenic
1193612325 X:83647635-83647657 TGGCATCTGCTTGGATTCTGGGG + Intergenic
1193979567 X:88165218-88165240 TGGGATCTGCTGTGATTCTGGGG + Intergenic
1195100899 X:101552959-101552981 TGGCCGCTGGTGTGGTTATCGGG + Exonic
1195994859 X:110721683-110721705 TGTCAGCTGCTGTACTTGTCTGG - Intronic
1199189190 X:144950783-144950805 TGGCATCTGCTGGGCTTCTGTGG + Intergenic
1200058203 X:153472465-153472487 TGGGAGGTGCTATGATTCTGGGG - Intronic
1200257844 X:154594269-154594291 TGGCATCTGCTCTGCTTCTGGGG - Intergenic
1200853563 Y:7911502-7911524 TGGCAGCTGCTGTGGATGGCAGG - Intergenic