ID: 968864573

View in Genome Browser
Species Human (GRCh38)
Location 4:3199761-3199783
Sequence ACTAGGCTGTTCCGCAGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968864568_968864573 24 Left 968864568 4:3199714-3199736 CCTTAACTTTGTTTCTAGGAATG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG 0: 1
1: 0
2: 0
3: 10
4: 71
968864570_968864573 -1 Left 968864570 4:3199739-3199761 CCGGAGAATCACAGCAGCTGCCA 0: 1
1: 0
2: 4
3: 31
4: 369
Right 968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG 0: 1
1: 0
2: 0
3: 10
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968864573 Original CRISPR ACTAGGCTGTTCCGCAGTGA TGG Exonic
902244990 1:15114938-15114960 GCTTGGCTGCTCCACAGTGACGG - Exonic
902540730 1:17152652-17152674 ACTAGGCTGTGCCCCAGTTAGGG - Intergenic
906748654 1:48239521-48239543 ACTTGCCTGTTCCTCAGGGATGG - Exonic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG + Intronic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
916315782 1:163446396-163446418 ACCAGGCTGTTCAGCAAAGATGG - Intergenic
917152102 1:171956644-171956666 ACTAGGCAGTGCCCCAGTAAGGG + Intronic
922575422 1:226658209-226658231 ACCAGGCTTTTCCCCAGTGAAGG - Intronic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923997438 1:239511087-239511109 ATGAGGCTGCTCAGCAGTGAAGG - Intronic
1062846851 10:714149-714171 ATGAGGCCGTTCCTCAGTGATGG + Intergenic
1066818576 10:39455066-39455088 ACTCGGGTGTTTCTCAGTGAAGG + Intergenic
1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG + Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1079602282 11:22324350-22324372 ACAAGGCTGTTCTGTAGTAAAGG - Intergenic
1086056600 11:82654217-82654239 ACTAGGCAGTGCCCCAGTAAAGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1091352533 11:134908599-134908621 ATAAGGCTCTTCCGCAGTGCAGG + Intergenic
1094637659 12:32242171-32242193 CCTAGGCTGGAGCGCAGTGATGG - Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1104246176 12:127043609-127043631 TCTAGGCTGAGCCACAGTGAAGG + Intergenic
1110948786 13:81458858-81458880 ACTAGGCTTTTCAGCAGAAAAGG + Intergenic
1111425669 13:88078007-88078029 ACTCGGCTGAACCCCAGTGAGGG - Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1118230795 14:63947223-63947245 AATAGGATTTTCTGCAGTGATGG + Intronic
1129621058 15:77146130-77146152 ACAAGGCTGCTGCACAGTGATGG - Intronic
1132542617 16:518119-518141 ACTAGGCTGGAGCGCAGTGGCGG + Intronic
1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG + Intronic
1141888921 16:86913422-86913444 ACTAGGCTGTAACGCAGTTGAGG + Intergenic
1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG + Intronic
1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
928438827 2:31274380-31274402 ACTAGGCTTTTCTGGAATGAGGG - Intergenic
937948718 2:127366843-127366865 ACTAAGCTGTCCCACAGTCAAGG + Intronic
943617202 2:190106896-190106918 TTTAAGCTGTTCCTCAGTGATGG - Intronic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
948274998 2:236701499-236701521 ACTTGGTTGTACTGCAGTGAGGG + Intergenic
949048224 2:241881979-241882001 ACTTGGCTGGGCCCCAGTGAAGG - Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1174556364 20:51398256-51398278 ACTCTGCTGTTCCCCAGTGCCGG + Intronic
1183532916 22:38373845-38373867 ACTGGGCTGTTTCGCAGGGTAGG + Intronic
1184981081 22:48096481-48096503 ACTAGGCTGATCCACAGAGTGGG - Intergenic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
956067465 3:65412189-65412211 AGGAGGCAGTTCCGCAGTGGAGG - Intronic
956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG + Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG + Intronic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG + Intergenic
976475212 4:85475388-85475410 ACTGGGCTGCTCCGCAGCGCGGG - Exonic
981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG + Intergenic
982366995 4:154590070-154590092 AATACGCTTTTCCGCAGTAATGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
984406326 4:179336190-179336212 ACTATTCTGTTCCACAGTGGGGG + Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986533424 5:8761979-8762001 ACTAGGCAGTGCCCTAGTGAGGG - Intergenic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1000450733 5:161383674-161383696 AATAAATTGTTCCGCAGTGATGG - Intronic
1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1001246473 5:170108691-170108713 TCTGGGCAGTTCCGCAGTCATGG - Exonic
1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG + Intergenic
1015952876 6:138571784-138571806 AAGAGGCTGTTTCGCAGTGATGG - Exonic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021946788 7:25735583-25735605 TCTGGGCTGTTCAGCAGTGAAGG - Intergenic
1024139248 7:46445280-46445302 TCTATTCTGTTCCACAGTGAAGG - Intergenic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1045071929 8:98515338-98515360 ACTAGTCTGTTCAGCAGACATGG + Intronic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1198941696 X:141963835-141963857 ACTAGGCAGTGCCCTAGTGAGGG + Intergenic