ID: 968865619

View in Genome Browser
Species Human (GRCh38)
Location 4:3209456-3209478
Sequence CGAATAGAGCCTAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968865619_968865625 8 Left 968865619 4:3209456-3209478 CCTGCCTTCTTAGGCTCTATTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 968865625 4:3209487-3209509 CTGCCCTGCCCTGGTTGCTGGGG 0: 1
1: 1
2: 6
3: 46
4: 438
968865619_968865621 -1 Left 968865619 4:3209456-3209478 CCTGCCTTCTTAGGCTCTATTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 968865621 4:3209478-3209500 GCTAAGCACCTGCCCTGCCCTGG 0: 1
1: 0
2: 1
3: 32
4: 313
968865619_968865622 6 Left 968865619 4:3209456-3209478 CCTGCCTTCTTAGGCTCTATTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 968865622 4:3209485-3209507 ACCTGCCCTGCCCTGGTTGCTGG 0: 1
1: 1
2: 1
3: 41
4: 301
968865619_968865624 7 Left 968865619 4:3209456-3209478 CCTGCCTTCTTAGGCTCTATTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 968865624 4:3209486-3209508 CCTGCCCTGCCCTGGTTGCTGGG 0: 1
1: 0
2: 7
3: 65
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968865619 Original CRISPR CGAATAGAGCCTAAGAAGGC AGG (reversed) Intronic
901098794 1:6703196-6703218 CCAAAAGATCCTAAGAGGGCTGG - Intergenic
911517851 1:98889906-98889928 TAAATAGTGCCTTAGAAGGCAGG + Intergenic
911863430 1:102985759-102985781 ATGATAGAGCCTAAGAAGACAGG + Intronic
916317855 1:163470483-163470505 CTAACAGAGCCTCAGAAGTCAGG - Intergenic
916733771 1:167589268-167589290 TGCCTAGAGCCTAAGAATGCTGG - Intergenic
922674705 1:227543122-227543144 TGAAAAGAGCCTAAGAAGAGGGG - Intergenic
1062759985 10:11010-11032 TGAAAAGAGCCTAAGAAGAGGGG + Intergenic
1065376544 10:25048999-25049021 AGAATAGCGATTAAGAAGGCTGG + Intronic
1066747531 10:38616053-38616075 TGAAAAGAGCCTAAGAAGAGGGG + Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1072789025 10:98304042-98304064 TGCATAGAGCCTAATAAGGATGG - Intergenic
1073454608 10:103628997-103629019 TGATTGGAGCCTAAGCAGGCTGG + Intronic
1083730272 11:64648988-64649010 CGCAGAGAACCTGAGAAGGCTGG - Intronic
1089629332 11:119774372-119774394 TGGACAGAGCCTAAGAAGGCAGG + Intergenic
1091096623 11:132828817-132828839 CAAAAAGTGCCTAAGTAGGCAGG + Intronic
1093941152 12:25056237-25056259 GGAAATGAGCCAAAGAAGGCGGG + Intronic
1094807523 12:34107394-34107416 TGAAAAGAGCCTAAGAAGAGGGG + Intergenic
1097092027 12:56514132-56514154 CCAAAATAGCCTAAAAAGGCCGG + Intergenic
1099918637 12:88928568-88928590 AGTCTAGAGACTAAGAAGGCAGG - Intergenic
1104759598 12:131289033-131289055 CTAATAGAGCATAGCAAGGCAGG + Intergenic
1104821115 12:131678179-131678201 CTAATAGAGCATAGCAAGGCAGG - Intergenic
1112575377 13:100630886-100630908 CTGATACAGCCTTAGAAGGCAGG + Intronic
1118319736 14:64746219-64746241 TGAACTGAGCCTAAGAGGGCTGG - Exonic
1118902272 14:69996455-69996477 AGAATACAGCCCAAGAAGACAGG - Intronic
1124653670 15:31490259-31490281 CAAAATGAGCCTAAAAAGGCCGG + Intronic
1127534508 15:59877486-59877508 CAACTAGAGCCTAGGAAGGGAGG - Intergenic
1138128059 16:54455034-54455056 AGAAGAGAGCTGAAGAAGGCAGG - Intergenic
1141547555 16:84781367-84781389 CGAATACAGCCTCAGGAGTCAGG - Intergenic
1148666613 17:49379661-49379683 GGAATGGATCCCAAGAAGGCTGG - Intronic
1149611442 17:57960249-57960271 CAAAGACAGCTTAAGAAGGCTGG + Intergenic
1150502899 17:65668190-65668212 AGAATAGTGCCCAAGGAGGCCGG - Intronic
1152952893 18:11363-11385 TGAAAAGAGCCTAAGAAGAGGGG + Intergenic
1159401080 18:67935104-67935126 TGAATAGAGACTAAGAAGACTGG - Intergenic
1163585554 19:18161574-18161596 CGTCTAGACCCTAAGAAGGGAGG + Intronic
1165077620 19:33289585-33289607 CAAATAGTTCCTAAGAAGGCAGG - Intergenic
1168299138 19:55393336-55393358 AGATTACAGCCTAAGGAGGCTGG - Intronic
934310497 2:91858183-91858205 TGAAAAGAGCCTAAGAAGAGGGG + Intergenic
936075220 2:109397520-109397542 CAAGTACAGCCTAAGAAGGAAGG + Intronic
936377794 2:111957224-111957246 AGAATAGACCTTAAGAAGGCAGG - Intronic
944541040 2:200753936-200753958 CCATCAGAGCCTAGGAAGGCAGG + Intergenic
946128844 2:217589046-217589068 CAAATAGGCCCGAAGAAGGCAGG - Intronic
948345638 2:237295437-237295459 TGAATGTAGCCTGAGAAGGCTGG + Intergenic
1169067127 20:2700352-2700374 GGAATAGAGCCTCTGAAGCCTGG - Intronic
1169498960 20:6141103-6141125 AGAAGAGAGCCAAAGATGGCAGG - Intergenic
1177743275 21:25179416-25179438 GGCGTAGTGCCTAAGAAGGCTGG - Intergenic
1180537245 22:16404122-16404144 TGAAAAGAGCCTAAGAAGAGGGG + Intergenic
1183607245 22:38872845-38872867 CGAATGGGGCCGAGGAAGGCCGG + Intergenic
950260458 3:11539679-11539701 CGAATATAGCTTAAGACGGGGGG - Intronic
952742802 3:36750376-36750398 TGAAAAGAACTTAAGAAGGCCGG - Intergenic
953977159 3:47390525-47390547 CCAATGGAGGCTGAGAAGGCAGG - Intronic
957921118 3:86749371-86749393 GGAATAGAGGCTAAGAAGAAAGG + Intergenic
959532197 3:107446317-107446339 TTAAGAGAGACTAAGAAGGCAGG + Intergenic
959593200 3:108101617-108101639 CTAATAGACCCCAAAAAGGCAGG - Intergenic
960531116 3:118766135-118766157 AGAATAGAGACTAGGAATGCAGG - Intergenic
964504038 3:157378929-157378951 TGATGAGAGCCTAAGAAGTCAGG - Intronic
968865619 4:3209456-3209478 CGAATAGAGCCTAAGAAGGCAGG - Intronic
972402174 4:38715646-38715668 GGAATAGAGACTAAGAAAGAAGG + Intergenic
978142021 4:105328918-105328940 CGAATACAGCCTCTGTAGGCAGG + Intergenic
978183640 4:105832957-105832979 TGAAAACAGCCTAGGAAGGCTGG - Intronic
989387387 5:40867165-40867187 AGGATAGAGCCTGAGAAGGCAGG - Intergenic
989520480 5:42395392-42395414 AGAATAGAACATAAGAAGACGGG + Intergenic
991477819 5:67042197-67042219 CAAACAGAGCCTAAGAAGGGAGG - Intronic
992212401 5:74493750-74493772 CTAAGAGATCCTAAGAATGCAGG + Intergenic
1007853318 6:44826953-44826975 CGATTACAATCTAAGAAGGCAGG + Intronic
1012286306 6:97393041-97393063 AGAATAGAGGCTTAGAAGGGAGG + Intergenic
1013073571 6:106751202-106751224 GGAATAGACGCTAAGATGGCAGG + Intergenic
1015020810 6:128472240-128472262 TGAATAGTGCCTCAGAAGCCCGG + Intronic
1019008268 6:168821855-168821877 GGAATAGAGCATAACAAAGCAGG + Intergenic
1020464165 7:8457576-8457598 TGAAAGGAGCCTCAGAAGGCAGG + Intronic
1021528174 7:21612257-21612279 AAAACAGAGACTAAGAAGGCTGG + Intronic
1037219769 8:16504550-16504572 AAAATAGAGCCAAAGAAAGCAGG + Intronic
1045890249 8:107147394-107147416 CTAAGTGAGCCTAAGGAGGCAGG - Intergenic
1049251734 8:141592929-141592951 AAAATAGAGCCAAGGAAGGCGGG - Intergenic
1186411358 X:9347208-9347230 CAAGGAGAGCCTAAGGAGGCCGG - Intergenic
1187132294 X:16514443-16514465 CCAATATAGCCACAGAAGGCTGG + Intergenic
1196588820 X:117461634-117461656 TGAATAGAGGCTGAGAAGGGTGG - Intergenic