ID: 968866044

View in Genome Browser
Species Human (GRCh38)
Location 4:3212585-3212607
Sequence GGCCCGGGCCAGAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 482}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968866044_968866052 -4 Left 968866044 4:3212585-3212607 CCCTGCCCACTCTGGCCCGGGCC 0: 1
1: 0
2: 7
3: 48
4: 482
Right 968866052 4:3212604-3212626 GGCCCTGGCACAGTACCTGGTGG 0: 1
1: 0
2: 4
3: 19
4: 225
968866044_968866051 -7 Left 968866044 4:3212585-3212607 CCCTGCCCACTCTGGCCCGGGCC 0: 1
1: 0
2: 7
3: 48
4: 482
Right 968866051 4:3212601-3212623 CCGGGCCCTGGCACAGTACCTGG 0: 1
1: 0
2: 4
3: 43
4: 396
968866044_968866055 -1 Left 968866044 4:3212585-3212607 CCCTGCCCACTCTGGCCCGGGCC 0: 1
1: 0
2: 7
3: 48
4: 482
Right 968866055 4:3212607-3212629 CCTGGCACAGTACCTGGTGGTGG 0: 1
1: 1
2: 1
3: 20
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968866044 Original CRISPR GGCCCGGGCCAGAGTGGGCA GGG (reversed) Exonic
900032662 1:382126-382148 GGACGGGGGCAGAGTCGGCAGGG - Intergenic
900053420 1:611188-611210 GGACGGGGGCAGAGTCGGCAGGG - Intergenic
900380549 1:2381882-2381904 GGCCCGGGCCAGTGTGGTGCCGG + Intronic
900418066 1:2544064-2544086 TGCCAGGGCCAGAGCGTGCAGGG - Intergenic
900470817 1:2854104-2854126 GGCCCTGGCCAGCCTGGGCCTGG - Intergenic
900586991 1:3437404-3437426 GGGACGGGACAGAGGGGGCAGGG - Exonic
900606568 1:3526214-3526236 TGCCCCGGCCAGAGAGGCCAAGG + Intronic
900623778 1:3598999-3599021 GGCCCGGCCCAGAGTAGGTGAGG - Intronic
901195753 1:7438990-7439012 CACCAGGGCCAGAGTGAGCAGGG + Intronic
902807908 1:18872348-18872370 AGCCCAGACCAGAGAGGGCAAGG + Exonic
902823303 1:18956408-18956430 CGGCCGGGCCAGGGTGGGCGCGG + Exonic
903022074 1:20401583-20401605 GGCCGGGGCAGGAGTGAGCAGGG - Intergenic
903029842 1:20455991-20456013 TCCCTGGGCCAGGGTGGGCATGG - Intergenic
903060135 1:20663609-20663631 GGCCTGGGATAGAGTGTGCAAGG + Intergenic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
903227930 1:21904345-21904367 GGCCAGGGCTGGAGAGGGCACGG + Intronic
903261392 1:22133544-22133566 GGGCCGGGCCAGGCTGTGCAGGG + Intronic
903652388 1:24929987-24930009 GGCCCGGGCCTCAGGGCGCAGGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904182018 1:28672702-28672724 CACCCAGGCCAGAGTGGGGAGGG - Intronic
904467760 1:30718421-30718443 GGGCGGGGCCAGAGCAGGCAGGG - Intronic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905655230 1:39682495-39682517 GTCCCTGGCCAGAAGGGGCATGG - Exonic
905876188 1:41433326-41433348 GCCTTGGGCCTGAGTGGGCAGGG + Intergenic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
907487271 1:54786754-54786776 GGCTGGGGCCAGACTGGGTATGG + Intronic
909364099 1:74799343-74799365 GGCTGGAGCCAGAGTGGGCCTGG + Intergenic
911208545 1:95117284-95117306 GACCCTGGCCAAAGTGGGCGGGG - Intergenic
912877025 1:113370553-113370575 GGCCCAGGGCAGAGTGGGGAAGG + Intergenic
913518330 1:119623578-119623600 GGGCCGGGCCAGCGGGGGCCCGG + Exonic
915090057 1:153417860-153417882 GGCCCTGGCCAGGATGGGCCGGG + Intronic
915095427 1:153459216-153459238 GGCCCTGGCCAGGATGGGCCAGG - Intronic
915267120 1:154726853-154726875 AGCCCGGGGGAGGGTGGGCAAGG + Intronic
915349092 1:155213414-155213436 AGCCCTGGGGAGAGTGGGCAGGG + Intronic
915352279 1:155234041-155234063 AGCCCTGGGGAGAGTGGGCAGGG + Intergenic
915367431 1:155323861-155323883 GGGCCGGGCGAGAGTGGGCGGGG - Intronic
915442316 1:155952695-155952717 GCCCCTGGGCAGGGTGGGCAGGG + Exonic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
919640105 1:200038802-200038824 GCCCCGGGCCAGGGTGGGGTGGG + Intronic
921060670 1:211581393-211581415 GGGGCGGGGCAGAGGGGGCAGGG + Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
922032194 1:221812338-221812360 AAGCGGGGCCAGAGTGGGCAGGG - Intergenic
922425186 1:225485656-225485678 AGCCCTGGGCAGTGTGGGCAAGG - Intergenic
922571058 1:226634933-226634955 GCCCCGGGCCGCAGTGGGGAGGG - Intronic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
923147607 1:231209137-231209159 GGCCAGGGCCAGCGTGGTCAAGG + Exonic
1062824234 10:556642-556664 GGGCCAGGCCCCAGTGGGCAGGG - Intronic
1065214724 10:23438943-23438965 GGCGCGGGCCGGAGTGGGCGGGG + Intergenic
1065797620 10:29321785-29321807 GGGCTGGGACAGAGTGAGCAGGG - Intergenic
1065913007 10:30326521-30326543 AGCCAGGGCCAAAGTGGTCAAGG + Exonic
1066961774 10:42232505-42232527 GGCCAGGGCCAGGGAGGGCCAGG + Intergenic
1069535113 10:69247543-69247565 GCTCCGGACCACAGTGGGCATGG + Exonic
1069942361 10:71964402-71964424 GGCTCGGGCCTGAGCGGGGAGGG + Exonic
1073176390 10:101560027-101560049 GGCCAGAGCCAGGGTGGGCCTGG - Intergenic
1075065393 10:119285813-119285835 GGACCTGGCCAGAGTAGGGAGGG + Intronic
1076280477 10:129242333-129242355 AGCCCAGGCCAACGTGGGCAGGG - Intergenic
1076675620 10:132146145-132146167 AGCCCGGGCCAGGGTGGGGGTGG - Intronic
1076746407 10:132517028-132517050 GGCCAGGGCCACAGTGGGGCGGG + Intergenic
1076935545 10:133566092-133566114 GGCCTCGGCCACTGTGGGCATGG - Intronic
1077106294 11:843955-843977 GGCCCTGGCCAGGGTGGGAGCGG - Intronic
1077231238 11:1459024-1459046 GGCCAGAGCCAGAGGGGGCGGGG - Intronic
1077321739 11:1945977-1945999 GAAGTGGGCCAGAGTGGGCAGGG - Intergenic
1077352120 11:2097844-2097866 AGCACGGGCCAGAGTGGGGAGGG - Intergenic
1077430071 11:2511921-2511943 GGCACAGGTCAGAGCGGGCATGG + Intronic
1077432253 11:2521751-2521773 GGCCTGTCCCCGAGTGGGCATGG + Intronic
1083264941 11:61542328-61542350 GGCCGGGGCCAGGCTCGGCAGGG - Intronic
1083623157 11:64058872-64058894 GGCCCAGGCCAGAGTGAAGATGG - Intronic
1084014219 11:66369231-66369253 GGCCCAGGCCAGAGGGGGCTGGG + Intronic
1084213406 11:67634162-67634184 GGCCGGGGCCACGGTGGGGACGG - Intronic
1084258079 11:67955959-67955981 GGGCCTGGCCAGAGCGGGCATGG - Intergenic
1085332910 11:75668056-75668078 GGCCCCGGCCGGAGCGGGCCGGG - Exonic
1085403581 11:76248602-76248624 GGCTGGGGCCAGAGAGGGCCAGG + Intergenic
1085512146 11:77093818-77093840 GGCCTCGGGCAGAGTGGGCAGGG + Intronic
1085743112 11:79093651-79093673 GGCCCAATCCAGAGTGGGGATGG + Intronic
1087007253 11:93482295-93482317 GGCCTGAGCCAGGGAGGGCATGG + Intronic
1089321483 11:117629507-117629529 GGGCCTGGACAGACTGGGCAGGG + Intronic
1089624423 11:119742325-119742347 GGCCCGGGGGTGGGTGGGCAGGG + Intergenic
1091219100 11:133920043-133920065 GGCCCGGGCGAGGCCGGGCACGG + Exonic
1202804757 11_KI270721v1_random:1290-1312 GAAGTGGGCCAGAGTGGGCAGGG - Intergenic
1091396670 12:157470-157492 GGCCCGGGGGAGGGTGGGCGGGG + Intronic
1091498346 12:991433-991455 GGCCCGGGCTGGGCTGGGCAGGG + Intronic
1091768535 12:3137285-3137307 GGCCCGGGGAAACGTGGGCAGGG - Intronic
1092046155 12:5432944-5432966 CGCCCGGGCCAGAGTGGTGCTGG - Intronic
1092160115 12:6311201-6311223 GGCCCGCCCTCGAGTGGGCAGGG - Intronic
1092428319 12:8390756-8390778 GGGCCTGGTCAGAGCGGGCATGG - Intergenic
1092429404 12:8396908-8396930 GGGCCTGGCCAGAGCGGGCCTGG - Intergenic
1095810888 12:46372448-46372470 GGCCCGGGCGAGAGTGGGGGAGG - Intronic
1096745222 12:53722401-53722423 GGCCAGGCCTAGAGTGGGGAGGG - Intronic
1096792043 12:54051541-54051563 GTTCCGGACAAGAGTGGGCAAGG + Intronic
1097916357 12:65024400-65024422 GGCCTCAGCCAGGGTGGGCAGGG - Intergenic
1098320613 12:69239814-69239836 GGCGCGGCCCAGAGGCGGCAAGG - Intronic
1102454912 12:113065379-113065401 GGCCCGGGCGAGCCTGGGAAGGG - Intronic
1102544605 12:113645654-113645676 GGCCAGGGGCAGAGAGGGCTGGG - Intergenic
1102772657 12:115492030-115492052 GGGCCAGGCCAGAGGAGGCACGG - Intergenic
1103058011 12:117836698-117836720 GACACGGGCCACAGTTGGCAAGG - Intronic
1103146488 12:118599544-118599566 GGCAGAGGCCAGAGTGTGCAGGG - Intergenic
1103362449 12:120362033-120362055 GGCCCGGGCCCCAGAGGGTAGGG - Intronic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104415885 12:128596364-128596386 GTCCTGGTACAGAGTGGGCAGGG + Intronic
1104513269 12:129401060-129401082 GGCCAGGCCCAGTGTGGGAAAGG - Intronic
1104836282 12:131793905-131793927 GGCTCGGGGGAGAGTGGGCACGG + Intronic
1105920509 13:24958946-24958968 AGCCGGGGGCAGAGTGGGGAGGG + Intergenic
1106382817 13:29256459-29256481 GGCTGAGCCCAGAGTGGGCAAGG + Intronic
1107086398 13:36431806-36431828 CCCTCGGGCCAGCGTGGGCAGGG + Intergenic
1107485254 13:40820522-40820544 GCCCCGAGCCATGGTGGGCATGG - Intergenic
1108594457 13:51937750-51937772 GGCCGAGGGCAGAGGGGGCAAGG - Intronic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1111974552 13:94951901-94951923 GGCCAGAGTCAGAGTGGGGAGGG + Intergenic
1112331890 13:98483147-98483169 GGCACGGGGCAGCCTGGGCAGGG + Intronic
1112692812 13:101916338-101916360 GGCCGGGGCCGGGGTGGGCCGGG + Intronic
1113741826 13:112716519-112716541 GAGCCGGGACAGAGGGGGCAAGG + Intronic
1113896258 13:113766277-113766299 GGCCTGGGCCGGGGAGGGCAGGG + Intronic
1114645939 14:24256166-24256188 GGACCGGGCCTGAGTGGGTGGGG - Intronic
1116436267 14:44897770-44897792 GCCCAGGGCCAGGGTGGGCGTGG + Intronic
1117499929 14:56341502-56341524 GGGACTGGGCAGAGTGGGCAGGG + Intergenic
1119473283 14:74912301-74912323 GGCCTGGCCCAGCGTGGGCAGGG - Intronic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119775095 14:77243260-77243282 GACCAGGGCTAGAGTGGGAAGGG + Intronic
1119895343 14:78215190-78215212 GGAGAGGGCCAGAGTGGGCTCGG - Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121312191 14:92941185-92941207 GTCCCGGTCCACAGTGGCCATGG + Exonic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1122024935 14:98868945-98868967 GGCATGGGCCAGAATGGGCCTGG - Intergenic
1122302315 14:100738290-100738312 GGCCCCGGGCAGGGTGGGCAGGG + Intergenic
1122386422 14:101351293-101351315 GGGCAGGGCCAGTGAGGGCAAGG + Intergenic
1122398278 14:101450720-101450742 GGCCAGGCCCAGAGGGGTCAGGG - Intergenic
1122906785 14:104805292-104805314 GGCCCAGGACAGGGTGGGGATGG + Intergenic
1123084554 14:105711449-105711471 GGGCCGGGCCGGACTGGGCCGGG - Intergenic
1123084564 14:105711469-105711491 GGGCCGGGCCGGATTGGGCCGGG - Intergenic
1123119167 14:105909011-105909033 GGCCCGGGCAAGGGTGGGTGGGG + Intergenic
1123995725 15:25716520-25716542 GCCCCAGGCTATAGTGGGCAGGG - Intronic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125279856 15:38031891-38031913 GCCCCAGGCCAGAGGGGGCCTGG - Intergenic
1125298981 15:38234006-38234028 GACCCTGCCCAGATTGGGCAAGG + Intergenic
1125519412 15:40339777-40339799 GGCCAGGGGTAGGGTGGGCATGG - Intronic
1125527407 15:40385983-40386005 GGCTCACGCCAGAGTGGCCAAGG + Intronic
1126600593 15:50423897-50423919 GGCCCCGGCGAGGCTGGGCACGG - Intergenic
1127384695 15:58457842-58457864 GGCCCGGGATAGAGTGGAAAAGG - Intronic
1127983384 15:64050437-64050459 GGCACAGGGCAGAGTGGGCATGG - Intronic
1128154653 15:65385020-65385042 GGCCCGGGTCAGAGCCGGCCGGG + Exonic
1128211966 15:65909281-65909303 GGCCAGGGCCAGCGGGGCCAGGG + Intronic
1128422243 15:67504311-67504333 GGCCCGAGACAGAGAGGGCTGGG - Intergenic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1129161628 15:73751242-73751264 GCCCAGGGCCAGGGTGGGCTGGG - Exonic
1129232844 15:74206233-74206255 TGCCCGCACCAGACTGGGCAGGG - Intronic
1129249846 15:74302810-74302832 GAGCTGGGCCAGACTGGGCAGGG - Intronic
1129877882 15:78988630-78988652 GGCCCTGGCCAAGGTGGTCAGGG + Intronic
1130137872 15:81197012-81197034 GGCCTGGGTCAGAGCCGGCAAGG - Intronic
1130770595 15:86919907-86919929 GGCCCATGGCAGAGTGGGCCAGG - Intronic
1131098267 15:89669551-89669573 GGCCCGGGCCATGGTCTGCACGG + Exonic
1131215185 15:90530209-90530231 GGCCCGGGCCGGCGCGGGCGGGG + Intronic
1132288727 15:100684801-100684823 GGCGCGGGTCACAGTGGGCCTGG + Intergenic
1132462859 16:63914-63936 GACCAGGGTCTGAGTGGGCAAGG + Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132651083 16:1021730-1021752 GCCGCTGGCCAGAGTGGGGACGG - Intergenic
1132709547 16:1260281-1260303 GGGCCAGGCCAGTGTGGGCAGGG - Intergenic
1132886624 16:2185074-2185096 GGCCAGGGCCAGGGTGGCCAGGG - Intronic
1132968613 16:2673614-2673636 GGCCCGGCCCCGCCTGGGCAGGG + Intergenic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1133328721 16:4958196-4958218 GGGCGGGGCCAGAGTGGGGCGGG + Intronic
1133438545 16:5801081-5801103 GGCCCCGCCCAGAGTGTGTACGG + Intergenic
1134012627 16:10866548-10866570 GGCCCCGGCCACAGTGACCATGG + Intergenic
1134452017 16:14369421-14369443 GGCACAGGCCAGAGTGAGGAAGG + Intergenic
1134896894 16:17896280-17896302 GGCCCAGCCCAGACTGGGAAAGG + Intergenic
1136390843 16:29963230-29963252 GGCCCAGGCCAGAGAGGCCAAGG - Exonic
1136408787 16:30064799-30064821 GGACCGGGCCGGGGTGGGGATGG + Intronic
1136460630 16:30407969-30407991 GGCCAGGGCCACGGTGGGCGGGG + Intronic
1136718217 16:32301620-32301642 GGCCAGGGCCAGAGCTGTCAGGG + Intergenic
1136800133 16:33062394-33062416 GGCCCGGGCCTTGGTGGGGATGG - Intergenic
1136836591 16:33507890-33507912 GGCCAGGGCCAGAGCTGTCAGGG + Intergenic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1138179819 16:54933493-54933515 GGCCCGGGACACGGTGGGCATGG - Exonic
1138245291 16:55462809-55462831 GACCTGGGCCTGGGTGGGCAGGG + Intronic
1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG + Intronic
1139576901 16:67847434-67847456 GGCCCGCTCCAGAGTCAGCATGG + Exonic
1140470193 16:75209433-75209455 GGCCTTGGCCAGAGTGGGAGCGG + Intergenic
1140700318 16:77575303-77575325 GGCCAGGGCCAGAGAGGGGCAGG + Intergenic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141435757 16:83998909-83998931 GGCCAGGGCCAGAGTGGAGGGGG + Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141804642 16:86334691-86334713 GGCCTGGGTCAGAGGGGGCCTGG + Intergenic
1141838104 16:86555863-86555885 GGCTGGGGCCAGAGAGGGAATGG - Intergenic
1142208000 16:88793095-88793117 GGCAGGGGCAGGAGTGGGCAGGG - Intergenic
1142357064 16:89606215-89606237 GGGGCAGGCCAGAGTGGGGAGGG + Intergenic
1203008211 16_KI270728v1_random:216145-216167 GGCCAGGGCCAGAGCTGTCAGGG - Intergenic
1203146778 16_KI270728v1_random:1808191-1808213 GGCCAGGGCCAGAGCTGTCAGGG + Intergenic
1142597698 17:1037579-1037601 ACCCAGGGACAGAGTGGGCAGGG + Intronic
1142714019 17:1738218-1738240 GGCCCTGGCCAGTGTGGGACCGG + Exonic
1143350633 17:6285623-6285645 GGCCAGGCCCAGAATTGGCATGG + Intergenic
1143358317 17:6347486-6347508 GGCCCGGGAAAGAGAGGCCAGGG - Intergenic
1144218155 17:13075161-13075183 GGGCCGGGCGTGAGTGGCCAAGG + Intergenic
1144447138 17:15341602-15341624 GGCCAGGGCCAGACTGGTCTGGG - Exonic
1144672819 17:17142533-17142555 GGCCCGGGCCAGGCCGGGCATGG + Intronic
1144732675 17:17537518-17537540 GGCCTGGGCCAGCATGGGGAAGG - Intronic
1144742896 17:17594020-17594042 AGCCTGGGCCAGGCTGGGCATGG + Intergenic
1144762911 17:17717428-17717450 GGACCGTGCCAGGGTGAGCAGGG + Intronic
1145239058 17:21228980-21229002 GCCCAGGGCCAGAGAGAGCAGGG + Intergenic
1146268417 17:31468346-31468368 GGCCTGGGGCAGAGTGGAGAGGG + Intronic
1146465132 17:33080188-33080210 GGGCCAAGGCAGAGTGGGCAGGG + Intronic
1147388797 17:40097004-40097026 GGCCAGGGCCAGATTGGGAATGG - Intronic
1147606628 17:41777350-41777372 AGCCAGGGACAGAGTGGGGAAGG - Intronic
1147668529 17:42163712-42163734 GGCCCTGGCCAGCCAGGGCAGGG + Exonic
1148337538 17:46851646-46851668 GGCCAGGGCCAGCGCGGGCGGGG - Exonic
1148717880 17:49728720-49728742 GGCCCAGGCCAGGGTGGGTGAGG - Intronic
1148859390 17:50596227-50596249 GGCACAGGCCAGAGGGGGCTGGG - Intronic
1148875442 17:50684295-50684317 GGACAGGGCCTGACTGGGCAGGG - Intronic
1149477821 17:56978037-56978059 GGGCGGGGCCTGAATGGGCATGG - Intergenic
1149491872 17:57091014-57091036 GGCCCAGGCCAGAGAAGGGATGG - Intronic
1149772240 17:59331471-59331493 GGCCCGGCCCAGCCTGGGCTAGG - Intergenic
1151309335 17:73283871-73283893 GGGCCGGGCCACAGTCGCCATGG + Exonic
1151358015 17:73571777-73571799 GACCCCGGTCAGAGAGGGCAGGG - Intronic
1151494512 17:74451384-74451406 GGCCCGGGCGGGAGTAAGCAGGG - Intronic
1151540904 17:74764087-74764109 GGCCCGAGCCAAACAGGGCAGGG + Intronic
1151678157 17:75610460-75610482 GGCCCTGGGGAGAGTAGGCAGGG - Intergenic
1151679543 17:75616199-75616221 GGCCCGGGCCAGGGAGGGTGGGG + Intergenic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152001185 17:77646178-77646200 GGCCGGGTTCCGAGTGGGCACGG + Intergenic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152210500 17:79000679-79000701 TGCCAGGGCCAGTGTGGTCAGGG - Intronic
1152419251 17:80183183-80183205 GGCCCCGGCCAGAGGGTACAGGG + Intronic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1152924330 17:83080358-83080380 GCCCCGGGCCAGAGCGGGAAGGG + Intronic
1152924467 17:83080811-83080833 GGCCCGGGCCAGCCCGGCCACGG - Intronic
1152947278 17:83205059-83205081 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1154203333 18:12316035-12316057 GGCCTGGGGCAGACTGGGCCGGG - Intronic
1154224899 18:12494436-12494458 CTCCCAGGCCAGAGTGGTCATGG - Intronic
1155168229 18:23248071-23248093 GACCCGGGCCAGAGTGGGCCTGG + Intronic
1158505556 18:58044061-58044083 GCCCCGGGCCGGGGTGGGCGTGG + Intergenic
1160607894 18:80066065-80066087 GGCCCGGGAGTGAGTGTGCAGGG + Intronic
1160822099 19:1063516-1063538 GGGTGGGGCCAGAGTAGGCATGG - Intronic
1160844613 19:1160941-1160963 GGCCCCTCCCAGGGTGGGCAGGG + Intronic
1160875836 19:1295881-1295903 TGCCGGGGCCCGAGTGGGCGGGG + Intronic
1160942558 19:1627207-1627229 GGCTTGGGCCAGGGTGGGCTGGG - Intronic
1160991824 19:1863290-1863312 GGCCCGGGCCAGAAGCGGCGGGG + Exonic
1161063878 19:2228211-2228233 GGCCAGGGCCAGCCGGGGCAGGG - Intronic
1161328065 19:3672897-3672919 GGGCGGGGGGAGAGTGGGCAGGG + Intronic
1161332902 19:3696759-3696781 GGCCCGGGGCAGGCTGTGCAGGG + Intronic
1161594047 19:5142247-5142269 GGCCCAGGCCAGTGTGTGCCGGG - Intronic
1161680735 19:5678509-5678531 TGCCCCGGCCAGAACGGGCAGGG - Exonic
1161800986 19:6416689-6416711 GGCCCAGGGAAGAGGGGGCAAGG + Intronic
1161801237 19:6417709-6417731 GGCCAGGGGCAGGGTGGGCCAGG + Intronic
1161925642 19:7296887-7296909 GGCCCAGAGGAGAGTGGGCAAGG + Intergenic
1162057301 19:8072196-8072218 TGCCTGGGCCAGGATGGGCAGGG + Exonic
1162199516 19:9010413-9010435 AGCCGGGGCCAGACTGGGCTGGG - Intergenic
1162573142 19:11483884-11483906 GGGCGGGGTCAGAGTGGGCGGGG + Intronic
1162720006 19:12656695-12656717 GGCGGGGGTCAGAGAGGGCATGG + Intronic
1162771760 19:12953511-12953533 GGCCAAGGCCAGACTGGGGAGGG - Exonic
1162798100 19:13096826-13096848 GGCCCGGGCCGGAGCGTGCCCGG + Intronic
1162806724 19:13140993-13141015 GGCTCGGCCCAGGGTGGGGAGGG - Exonic
1163429150 19:17256567-17256589 TGCACGGGGCACAGTGGGCATGG + Exonic
1163440995 19:17322516-17322538 GGGCTGGGCCAGTGTGAGCAAGG - Exonic
1163517598 19:17774491-17774513 AGCCTGGGCCAGACCGGGCAGGG - Intronic
1163518347 19:17778356-17778378 GGGCGGGGCCAGAGTGCGCGTGG + Intronic
1163618378 19:18342797-18342819 GGCCAGGGGCAGACTGGGAAGGG + Intronic
1164812860 19:31171821-31171843 GGCCTGGGGCAGAATGGACAGGG - Intergenic
1165093926 19:33400498-33400520 TGCCTGGGCCGGTGTGGGCAGGG + Intronic
1165741766 19:38209213-38209235 GGCCAGGGCCAAAGGAGGCAGGG - Intergenic
1165856831 19:38883970-38883992 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1166071932 19:40393013-40393035 GGGTGGGGCCAGAGTGGACAGGG + Intergenic
1166104032 19:40588939-40588961 GGGCAGGGCCAGAGAGGGCTGGG - Intronic
1166194198 19:41195458-41195480 GTCCCAGCCCAGAGTGGTCAGGG + Intronic
1166316412 19:41992207-41992229 GGCCAGGGCCAGGGTGAGCCAGG - Intronic
1166694832 19:44846515-44846537 GGCCCGGGCCATGGAGGGCCCGG - Exonic
1166809997 19:45508883-45508905 GGGCGGGGCCAGTGTGGGCAGGG + Intronic
1166826021 19:45609695-45609717 GGCCCTGACCACAGGGGGCAAGG - Exonic
1167268969 19:48497711-48497733 GGGCCGAGCCCCAGTGGGCACGG - Exonic
1167376368 19:49114461-49114483 GGCCGCGGCCCGGGTGGGCAGGG - Intronic
1167391834 19:49200442-49200464 GGGCGGGGCCAAAGTGGGCGGGG + Intronic
1167446742 19:49542526-49542548 GGGCCGGGACAGAGGGGACAAGG - Intronic
1167703432 19:51064894-51064916 GACCCGGCCCCGAGTGGGCGGGG + Intronic
1167723568 19:51195840-51195862 CGTCTGGGCCAGAGTGGGCCCGG + Intergenic
1168113883 19:54209954-54209976 GGCTGAGGCCAGAGAGGGCAGGG + Intronic
1168269979 19:55244513-55244535 AGCACAGGCCAGGGTGGGCAGGG + Intronic
926297743 2:11580879-11580901 GGCCAAGGCCAGAGGGGGCATGG + Intronic
926931619 2:18046877-18046899 GGCCCAGTCCAGGGAGGGCAAGG - Intronic
927494781 2:23545092-23545114 GGCCCAGGCCAGGGTGGACGTGG + Intronic
927670413 2:25064143-25064165 AGCCAGGGCCAGGGTGGTCACGG - Intronic
927927912 2:27026057-27026079 GGGCCAGGCCAGACTGGGGAGGG - Intronic
929811340 2:45191431-45191453 TTGCCCGGCCAGAGTGGGCAGGG + Intergenic
929883786 2:45860715-45860737 AGCACTGGCCAAAGTGGGCAGGG - Intronic
929959826 2:46488091-46488113 GGCCCGGCCCAGATTGGCTACGG - Intergenic
933636426 2:84713482-84713504 GGCCTGGGCCCCAGTGGGTAGGG - Intronic
933767570 2:85720503-85720525 GGCAGGGGCTAGATTGGGCAGGG + Intergenic
934655546 2:96115300-96115322 GGCCCTGGCCTGAGTTGGGAAGG + Exonic
935590846 2:104844592-104844614 GGCCCGGGCGAGAGAGCGCGTGG + Intergenic
936088279 2:109484411-109484433 GGTGCGGGCCAGAGTGTGGATGG - Intronic
937213011 2:120289736-120289758 GACCCGGGCCAACGTGGACAAGG + Exonic
937518929 2:122687129-122687151 TGCCAGGGTCAGAGTGGGGAGGG + Intergenic
937988308 2:127648553-127648575 GGCACGGGGCAGAGAGGGCATGG - Intronic
938099242 2:128486840-128486862 GCCCCGTGGCAGAGTAGGCATGG - Intergenic
938427443 2:131203129-131203151 CACCCGGCCCAGAGGGGGCAGGG - Intronic
938468387 2:131537177-131537199 CACCCGGCCCAGAGGGGGCAGGG - Intergenic
941486058 2:166084277-166084299 GGCACAGTCCAGAGTGGGAAGGG - Intronic
942678151 2:178450528-178450550 GGCCAGGGCCAGAGCTGGCGAGG + Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946396391 2:219445690-219445712 GGCCAGGGGCAGATGGGGCAAGG + Intronic
947728857 2:232417247-232417269 GGCCCGGGTCAGCCTGGGCCAGG - Intergenic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
949025286 2:241764958-241764980 GGCCAGGGCCAGGGTGTGCTTGG + Intronic
1171285771 20:23937183-23937205 GGGCTGTGCCAGAGTTGGCAGGG + Intergenic
1171784415 20:29449149-29449171 GGCCAGGGCCAGGCTGGGCCAGG + Intergenic
1172481105 20:35271844-35271866 GGGCCGGGCCAGGGTGGGCATGG + Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173572690 20:44087745-44087767 GGCTCTGGCGGGAGTGGGCAGGG - Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173822415 20:46028276-46028298 GGCCAGGGACAGAGTGGGGGAGG - Intronic
1174498267 20:50965138-50965160 GGCCAGGGCCAGATGGCGCAAGG + Intergenic
1174767142 20:53265121-53265143 GGCCAGGGCCAGAGCGTTCAGGG + Intronic
1175228885 20:57461072-57461094 TGCCCAGGACAGAGTGGACATGG + Intergenic
1175396697 20:58669322-58669344 GGCCCGGGCCCGGCTCGGCAGGG - Exonic
1176109881 20:63406366-63406388 GGCCCTGAGCAGAGTGGACAGGG + Exonic
1176119379 20:63447104-63447126 GGCAGGGGCCAGAGTGGAGAGGG - Intronic
1176143285 20:63554303-63554325 GGCCCGGGCCAGGGGAGCCAAGG + Exonic
1176242070 20:64079817-64079839 GGCCCGGGCCGGGAGGGGCAGGG + Intronic
1176298685 21:5088325-5088347 GGCCGGTGCCAGGGTGAGCAGGG + Intergenic
1176369820 21:6055990-6056012 GGCCAGGGCCAGGAGGGGCAGGG - Intergenic
1176372584 21:6071267-6071289 GCCCCAGGCCGGAGTGGGCAGGG + Intergenic
1178953832 21:37006429-37006451 GGCCCGGGCAAGGGTGGGGACGG - Intronic
1179605800 21:42514350-42514372 GGCCCGGGCCGGGGTGGGCAGGG - Exonic
1179750892 21:43466978-43467000 GCCCCAGGCCGGAGTGGGCAGGG - Intergenic
1179753699 21:43482551-43482573 GGCCAGGGCCAGGAGGGGCAGGG + Intergenic
1179858341 21:44173624-44173646 GGCCGGTGCCAGGGTGAGCAGGG - Intergenic
1179880653 21:44292090-44292112 GGCCCTGGCCAGCGTGATCAGGG - Intronic
1179998841 21:44986113-44986135 GGCCCAGGCCAGCCCGGGCAGGG + Intergenic
1180078078 21:45473231-45473253 CGCCAGGGCCCGAGAGGGCAGGG + Intronic
1180622614 22:17171910-17171932 GACCCCGGCCAGAGAGAGCAGGG + Intergenic
1180876383 22:19177064-19177086 GACCTGGGCCAGGGTGGGAAGGG - Intronic
1181028863 22:20140556-20140578 GGTCCAGGCCAGGGTGGGCAGGG - Intronic
1181057900 22:20268470-20268492 GGCCCGGGCCGGAGCCGGCCGGG + Exonic
1181103532 22:20557733-20557755 GGCCAAGGCCAGACTGGGGAGGG - Intronic
1181514437 22:23402901-23402923 GGCCCGGGCCGCAGTGGGCCAGG + Intergenic
1181579888 22:23822312-23822334 GGCCCCGTCCAGAGAGTGCATGG + Intronic
1181625743 22:24121057-24121079 GGCGAGGGCCAGAGAGGGCCAGG + Intronic
1181648664 22:24247191-24247213 GGCCCTGGCCAGAGTGCCCCTGG + Intergenic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182485553 22:30636582-30636604 TGGCCGGGCCCGAGTGGCCATGG + Exonic
1182669678 22:31985189-31985211 GGCCCAGGCCAGAGAAGACAGGG - Intergenic
1183346946 22:37313222-37313244 GGGCAGGGCCAGAGTGGGTGAGG - Intronic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1183741981 22:39673923-39673945 GGCCTGGGGCTGAGTGGGCAGGG + Intronic
1183810734 22:40255005-40255027 AGTTCGGGCCAGATTGGGCAAGG + Intronic
1183810823 22:40255714-40255736 AGTTCGGGCCAGATTGGGCAAGG - Intronic
1184272597 22:43393264-43393286 GGCCCGGCCCAGGCTGGGAAAGG - Intergenic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184486864 22:44785031-44785053 AGACCGGGACTGAGTGGGCAGGG + Intronic
1184648277 22:45907921-45907943 GGCTGGGTCCAGAGTGTGCAGGG - Intergenic
1184687832 22:46104472-46104494 GGCCAAGGCCAGACTGGGCGGGG - Intronic
1184805612 22:46793209-46793231 GGCACTGGCCAGAGTGAGCTGGG + Intronic
1184907375 22:47497892-47497914 GGGCAGGGCCTGAGTGGGGAGGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185277507 22:49956198-49956220 GGCCTGGGCCCCAGTGAGCATGG - Intergenic
1185313683 22:50170045-50170067 GGCCCGCGGGAGGGTGGGCAGGG - Intergenic
1185338730 22:50282381-50282403 GGTCAGGGCCAGGGTGGGCGGGG - Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
950197730 3:11021052-11021074 GGCCTGGCACAGAGTGGTCAAGG + Intronic
950741679 3:15057169-15057191 GGCCCCGGCCAGGGAGAGCACGG - Intronic
952188860 3:31000811-31000833 GGCCTGGGCCAGAGAGGAGATGG - Intergenic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
952897235 3:38085744-38085766 GACCTGTGCCACAGTGGGCAAGG + Intronic
953390466 3:42530957-42530979 GGCTGGGGACAGAGGGGGCAAGG + Intronic
953492338 3:43362668-43362690 GGCCTGCACCAGGGTGGGCAGGG - Intronic
953808211 3:46089818-46089840 GGCCCAGGCCTGAGTGTGCCAGG + Intergenic
954116440 3:48469330-48469352 GGGCAGGGCTAGAGTTGGCAGGG + Intronic
954131025 3:48561026-48561048 GGCACGGGACAGCGTGGGGAGGG - Intronic
954304257 3:49717218-49717240 GCCCCAGGCCAGAGAGAGCAGGG + Exonic
954582011 3:51707950-51707972 GGCCATGGCTAGGGTGGGCAGGG + Intronic
954796030 3:53161705-53161727 GGCCCGGGAGAGAGTCGGGAGGG - Intronic
954952682 3:54489119-54489141 GGCAGAGGCCAGAGTGAGCAGGG + Intronic
955326583 3:58013312-58013334 GGCCAGCGCCAGAGCAGGCAGGG + Intronic
955829595 3:62986927-62986949 GGGCTGGGGCAGAGTGGGCTAGG - Intergenic
958779415 3:98522973-98522995 GGCCCGGCCCGGAGTGGGGGCGG - Intronic
960175004 3:114506779-114506801 GGCCGGGGCCAGATTGTGAAAGG - Intronic
961281061 3:125766310-125766332 GGGCCTGGCCAGAGCGGGCCTGG + Intergenic
961577718 3:127851794-127851816 GTCCTGGGCCTGAGTGAGCAAGG - Intergenic
962020570 3:131496897-131496919 GGCCTGGGCCAGTGTTGGGAGGG - Intronic
962919019 3:139934977-139934999 GGCCCGGTCCCGACTGGGCAGGG + Intergenic
963814304 3:149812845-149812867 GGCGCGGGACCGAGCGGGCAGGG - Exonic
964259002 3:154812077-154812099 GACACTGGCCAGAGTGGCCAAGG - Intergenic
966182025 3:177197044-177197066 GGCGCGGGCCAGAGGCGGCCGGG - Intronic
968481412 4:834713-834735 GGCAGGGGCCAGAGACGGCAGGG + Intergenic
968541170 4:1169166-1169188 GCACTGGGCCACAGTGGGCAGGG - Intronic
968553471 4:1236107-1236129 ACCCCAGGCCAGAGTTGGCAAGG + Intronic
968584827 4:1411444-1411466 GGCAGAGGCCAGAGAGGGCAGGG - Intergenic
968648532 4:1751443-1751465 GGCCCGGGACAGAGAGGGCATGG - Intergenic
968800813 4:2742345-2742367 GGCGCGGCCCAGAGAGGCCAGGG - Exonic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
968885082 4:3324598-3324620 GGCCCTTGACAAAGTGGGCAAGG + Intronic
969016627 4:4107764-4107786 GGGCCTGGCCAGAGCGGGCCTGG - Intergenic
969459675 4:7322302-7322324 GGCCCAGGACAGAGGGGGCATGG - Intronic
969699679 4:8761328-8761350 GGCCCAGGCCAATCTGGGCATGG - Intergenic
970326361 4:14928953-14928975 GGCCCTGGACAGAATAGGCATGG - Intergenic
972290645 4:37686823-37686845 CGGCCGGGCCACGGTGGGCAGGG - Intergenic
975122933 4:70748838-70748860 GGCCCAGGAAAGAGTGGTCAGGG + Intronic
975406767 4:73998964-73998986 GGCCTGTGCCAGAGCGGGCTAGG + Intergenic
976186773 4:82449842-82449864 GGGCTGGGCCAGAGTGAGCTGGG - Intronic
985073694 4:186191969-186191991 GGCGCGGGCCACCGTGGGGATGG - Exonic
985478381 5:92270-92292 CGCCCGGGTAAGAGGGGGCACGG + Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
985943949 5:3162466-3162488 GCCCCGGACCAGGGTGGGGATGG - Intergenic
985972060 5:3386123-3386145 GGCCAGCTCCAGAGTGCGCAGGG + Intergenic
989204566 5:38798004-38798026 GTCGCGGGCCAGAGTGGTCCTGG + Intergenic
989361138 5:40602637-40602659 GGCCTAGGCCAGAGCTGGCAAGG - Intergenic
989455363 5:41637576-41637598 GGCCTGAGGCTGAGTGGGCAGGG - Intergenic
992080897 5:73233748-73233770 GGCCCGGCCCAGCGCGGGCGGGG - Intergenic
992199490 5:74369432-74369454 GGCCCTGGCCACACTGGGAACGG - Intergenic
992377196 5:76199627-76199649 CGCCCATGGCAGAGTGGGCATGG + Intronic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
992866231 5:80960196-80960218 GGCCCGGGCCGGGGCGGGCGAGG + Intergenic
994353807 5:98773731-98773753 GGCCCCAGCCAGCGTGGGCTCGG - Intronic
996276779 5:121676282-121676304 GGGCTGGGCAATAGTGGGCAGGG - Intergenic
997129548 5:131263706-131263728 GGCCCGGGCCGGGGTGGGAAGGG + Intronic
997310662 5:132878204-132878226 TGCCTGGGCCAGACTGGGCTGGG - Exonic
997745394 5:136295555-136295577 GGCCTGGGCCACAGTGGACGGGG - Intronic
1000576051 5:162976295-162976317 TACCTGGGCCAGTGTGGGCAGGG + Intergenic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002259929 5:177985828-177985850 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002259937 5:177985858-177985880 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259941 5:177985873-177985895 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259945 5:177985888-177985910 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259961 5:177985961-177985983 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002421914 5:179153384-179153406 GGACCGGCCCAGTGTGGGGAGGG - Intronic
1002450666 5:179316613-179316635 GGCCCAGGGCAGAGCAGGCACGG + Intronic
1002741158 5:181436742-181436764 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1002876650 6:1216350-1216372 GGCCAGGGCCAGAGTGAGGCAGG - Intergenic
1003603796 6:7541969-7541991 GGTCCGGGCCAGACTCGGCGCGG - Exonic
1004043874 6:12008928-12008950 GGCGTGGGGCAGAGTTGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006106396 6:31719404-31719426 GGCCAGGGACAGAGTTGGGAAGG - Intronic
1006379485 6:33689210-33689232 GGCCAGGGGCAGGGTGAGCAGGG - Intronic
1007048118 6:38798031-38798053 GGCCCAGGCTGGAGTGGACACGG - Intronic
1007239248 6:40413389-40413411 GGCCTGGGCCTGGGTGGGCCAGG + Intronic
1007253719 6:40513954-40513976 GGGCCTGGCCAGAGAGGACAAGG + Intronic
1007733276 6:43964895-43964917 GGCCCAGTGCAGATTGGGCAAGG - Intergenic
1008876810 6:56338453-56338475 GGCCAGGGTGAGAGGGGGCAGGG - Intronic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1009995167 6:70888814-70888836 GGCCCAGGCCAGGGTAGGGAGGG - Intronic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1015310549 6:131762397-131762419 GGGCCGGGGCAGCGGGGGCAGGG - Intergenic
1016809681 6:148247839-148247861 GGGAGGGGCCAGAGTGGCCAGGG - Intergenic
1017913998 6:158818502-158818524 GGCCCGGGAGAGAGAGGGCAGGG + Intronic
1017983777 6:159424919-159424941 GGCTGAGGCCAGAGTGTGCAAGG - Intergenic
1018742935 6:166744306-166744328 GGCCTCGGCCAGCGTGTGCAGGG + Intronic
1018907271 6:168082873-168082895 GGCCTGGGGCAAGGTGGGCAGGG + Intergenic
1019246272 6:170712439-170712461 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1019384459 7:746686-746708 GACCCTGGGCAGGGTGGGCAGGG - Intronic
1019569814 7:1705656-1705678 GGGCAGGGCCAGAAAGGGCAAGG - Intronic
1019594133 7:1850598-1850620 GGCCTGGGCCGGAGAAGGCACGG + Intronic
1019701575 7:2476953-2476975 GGCGGGGGCCAGGGTGGGCTGGG - Intergenic
1019705025 7:2493490-2493512 GGCCTGGGGCGGAGTGGGGAGGG + Intergenic
1020007962 7:4792309-4792331 GGGCGGAGCCAGAGTGGGGAGGG - Intronic
1022112386 7:27239640-27239662 GGCCCGGGCCGGAGGGGGGTGGG - Intergenic
1022427895 7:30285339-30285361 GGCCCGGGGCAGGGCGGACATGG + Exonic
1022469085 7:30670934-30670956 GGCCTGGGCCACTCTGGGCATGG - Intronic
1022520035 7:31000356-31000378 GGCCAGGGCTAATGTGGGCAGGG + Intergenic
1023208092 7:37773156-37773178 GGCAGGGGGCAGAGTGGGAATGG - Intronic
1023828819 7:44027856-44027878 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1023834448 7:44060096-44060118 GGCCAGGGGCTCAGTGGGCAAGG + Exonic
1023839422 7:44088070-44088092 GGCCTGGGCAGCAGTGGGCAGGG + Intergenic
1023986501 7:45100208-45100230 GACCTTGGCCAGAGTGGGGAGGG - Exonic
1024283737 7:47739473-47739495 GACCTGGGCCACAGTGGGGACGG + Intronic
1025941605 7:66079419-66079441 GGCATGGGACAGAGTGGGGAGGG - Intronic
1026444458 7:70471921-70471943 TGACCGGGCCAGAGTGGAGAGGG + Intronic
1029075102 7:97928564-97928586 GGGCCTGGCCAGAGCGGGCCTGG - Intergenic
1029360972 7:100088595-100088617 GGCCGGGGCCAGATCAGGCAGGG + Intergenic
1029739118 7:102482113-102482135 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1029757119 7:102581292-102581314 GCCCCGGGGCAGGGTGGGCAGGG - Exonic
1029775060 7:102680353-102680375 GCCCCGGGGCAAGGTGGGCAGGG - Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1030769343 7:113455021-113455043 GTCCAGGGCAAGAGTAGGCATGG - Intergenic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1031972447 7:128074448-128074470 GGGCCAGGCCTGAGTGTGCAGGG - Intronic
1032074310 7:128829409-128829431 GACCAGGGGCAGAGTGGTCAGGG - Intergenic
1032080528 7:128856383-128856405 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1032091576 7:128914167-128914189 GGCAGGGGCCAGGCTGGGCATGG - Intergenic
1032669840 7:134072912-134072934 GGCCCAGGCTAGGCTGGGCATGG + Intergenic
1033335565 7:140449369-140449391 GGCCTGGGCTAGTGTGGCCATGG - Intergenic
1033361235 7:140640473-140640495 GGGCCGGGCCAGGGGGTGCAGGG - Intronic
1033368569 7:140689629-140689651 TGCCCGGGCCAGCGAGTGCAGGG + Exonic
1034182224 7:149147718-149147740 GGCCCGGGCTAGACAGCGCAGGG + Exonic
1034222990 7:149460149-149460171 GGCCCGGGCCGGACAGCGCAGGG - Intronic
1034338946 7:150340402-150340424 GGCCCGGGCAGGAGCGGGGAGGG - Intronic
1035255358 7:157622474-157622496 GGAACGGGCCCCAGTGGGCAGGG - Intronic
1035501800 8:95250-95272 GGACGGGGGCAGAGTCGGCAGGG - Intergenic
1036242429 8:7091814-7091836 GGGCCTGGCCAGAGCGGGCCTGG + Intergenic
1036830308 8:12015317-12015339 GGGCCTGGCCAGAGCGGGCCTGG - Intronic
1036899388 8:12659616-12659638 GGGCCTGGCCAGAGCGGGCCTGG - Intergenic
1036900455 8:12665763-12665785 GGGCCTGGCCAGAGCGGGCCTGG - Intergenic
1037719089 8:21427478-21427500 GGGCCAGGCCAGAAGGGGCATGG + Intergenic
1043515395 8:80990599-80990621 GGCCTGGGTCAGAGAGGACAAGG + Intronic
1045269402 8:100649416-100649438 GGCTGGGGTCAGGGTGGGCAGGG - Intronic
1045320799 8:101080343-101080365 GGCCCAGGGCAGAGAGGTCAGGG + Intergenic
1046521421 8:115330880-115330902 GGCCAGCGCAAGGGTGGGCATGG - Intergenic
1048328191 8:133454469-133454491 GGCCAGGGCCTGATTGGGCTGGG - Intergenic
1049171901 8:141166807-141166829 GGCCAGGGCTAAAGTGAGCAGGG + Intronic
1049389186 8:142359337-142359359 GGACCGGGCCAGCGTGGGTGAGG - Intronic
1049471061 8:142775203-142775225 GGCCAGGGCCAGGGTGGCCGGGG + Intronic
1049472654 8:142783274-142783296 GGCCGGGGCCGGAGGGGGCTCGG - Intergenic
1051166831 9:14271251-14271273 GGCCCAGGCGAGATTGGGCCAGG - Intronic
1051225334 9:14892806-14892828 TGCCTGGGGCAGAGTGGGGAAGG - Intronic
1051789364 9:20783083-20783105 GGGCAGGGCAAGAGTTGGCAGGG + Intronic
1052840853 9:33289858-33289880 GGCTCGGCCCAGGGTGGGGAGGG - Intergenic
1053131570 9:35618511-35618533 GGCCAGGGCCAGAGGGGCCACGG + Intronic
1056684947 9:88751906-88751928 GGCTGGGCCCAGGGTGGGCACGG + Intergenic
1059389348 9:113989017-113989039 GGCCCAGGCCAGAAGAGGCAGGG - Intronic
1060478049 9:123999995-124000017 GGCCCGGGCCGGAGGGCGGAGGG - Intergenic
1060827146 9:126693833-126693855 GGCCTGGGCCAGGGTGAGCTGGG + Exonic
1061042477 9:128148203-128148225 GGACAGGGCCTGAGGGGGCAGGG + Intergenic
1061646729 9:132009017-132009039 GGCCACGGGCAGAGTGGGGAGGG - Intronic
1061672123 9:132194626-132194648 GGCCCGGGCCAGGGTAGGACTGG - Intronic
1061766044 9:132882098-132882120 GGCCTGGGCCAGGGCAGGCAGGG - Intronic
1061808495 9:133149235-133149257 GGCTCGGGCCCGGGTGGGCGGGG + Intronic
1061869622 9:133513774-133513796 GGGTGGGGCCAGAGTGGGCTGGG + Intergenic
1062004644 9:134233120-134233142 GAGCAGGGCCAGAGTCGGCATGG - Intergenic
1062421366 9:136484120-136484142 GGCTGGGGCCAGGGTGGGCCTGG - Exonic
1062499761 9:136847392-136847414 GGGCGGGGCCTGAGTGGGCAGGG - Exonic
1062522520 9:136964155-136964177 CTCCAGGGCCAGGGTGGGCACGG - Intergenic
1062554540 9:137107990-137108012 GGCCTGGTCCACAGTGGGGATGG - Intronic
1062586984 9:137253917-137253939 GCCCTGGGCCAGAGTGTTCAGGG - Intergenic
1062596951 9:137303799-137303821 GGCCCGGGGCAGGGATGGCATGG + Intergenic
1203607036 Un_KI270748v1:67822-67844 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1185891410 X:3825434-3825456 GGTCGGGGCCACAGAGGGCACGG + Intronic
1185896517 X:3863848-3863870 GGTCGGGGCCACAGAGGGCACGG + Intergenic
1185901635 X:3902274-3902296 GGTCGGGGCCACAGAGGGCACGG + Intergenic
1186107820 X:6226408-6226430 GGCCCGGGCCACCCTGGGAACGG - Intronic
1186496347 X:10015237-10015259 GGCCCGGGCGAGCAGGGGCAGGG - Intergenic
1186517459 X:10176608-10176630 GTCCCCTGCCAGCGTGGGCAGGG - Intronic
1187500148 X:19832746-19832768 GGGCTAGGCCAGTGTGGGCATGG - Intronic
1188066993 X:25674398-25674420 GGCCCTGGCCAGAGTCAGCATGG + Intergenic
1189847466 X:45150308-45150330 GGCCAGGGCAAGAGTGTACATGG + Exonic
1190053739 X:47170305-47170327 GGCCCTGGCCAGGGTGGGAATGG + Intronic
1191111272 X:56804557-56804579 GGCCCAGGCGAAAGTGAGCATGG - Intergenic
1195683487 X:107565609-107565631 TGCCTGGGCCAGAGAGGTCAAGG + Intronic
1198051851 X:132958243-132958265 GGCCAGGCCCCGAGTGAGCAGGG + Exonic
1199755049 X:150855997-150856019 GGTCAGGGCCAGACTGGGGAGGG - Intronic
1199933939 X:152553033-152553055 GTCCTGGGCTAGAGTTGGCAGGG - Intergenic
1200117180 X:153774500-153774522 GGCCCAGGCAGGCGTGGGCATGG + Exonic