ID: 968867672

View in Genome Browser
Species Human (GRCh38)
Location 4:3224201-3224223
Sequence GTCTTCCCGCATCACTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968867672_968867675 -3 Left 968867672 4:3224201-3224223 CCACACCAGTGATGCGGGAAGAC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 968867675 4:3224221-3224243 GACCTGAGTGTGGTCTGAGTTGG 0: 1
1: 0
2: 0
3: 26
4: 157
968867672_968867677 0 Left 968867672 4:3224201-3224223 CCACACCAGTGATGCGGGAAGAC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 968867677 4:3224224-3224246 CTGAGTGTGGTCTGAGTTGGAGG 0: 1
1: 0
2: 1
3: 25
4: 277
968867672_968867678 6 Left 968867672 4:3224201-3224223 CCACACCAGTGATGCGGGAAGAC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 968867678 4:3224230-3224252 GTGGTCTGAGTTGGAGGCTGTGG 0: 1
1: 0
2: 2
3: 50
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968867672 Original CRISPR GTCTTCCCGCATCACTGGTG TGG (reversed) Intronic
900808282 1:4782086-4782108 TTCTTCCCGCAGCACAGGAGTGG + Intronic
906362447 1:45175283-45175305 GATTTCTCCCATCACTGGTGAGG + Intronic
907598732 1:55745586-55745608 GTCTTCCAGAAACACTGGGGTGG + Intergenic
915460151 1:156065637-156065659 GTCAGCCTGCATCTCTGGTGAGG - Intronic
920297438 1:204967615-204967637 GTCTTCCCGAGTCATTAGTGAGG + Intronic
920665646 1:207960822-207960844 GTCTTACCGCAACTCTTGTGGGG - Intergenic
920733468 1:208510594-208510616 GTCTTCCCCCATCAGTAGGGTGG + Intergenic
922445415 1:225692850-225692872 GCCTTCCTGAAGCACTGGTGTGG + Intergenic
924105695 1:240646964-240646986 GTCTTCTCGCTTTAGTGGTGGGG - Intergenic
924129521 1:240891186-240891208 TTTTTCCAGCATCACTGGGGGGG + Intronic
1066686182 10:37983700-37983722 GACTTCCCACAACACAGGTGTGG + Intergenic
1068710348 10:60126960-60126982 GTCTTCCCCCATCCCTGGAAAGG - Intronic
1069643425 10:69972012-69972034 GTCTTCCCACATCACTCTTTTGG - Intergenic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1099347214 12:81517209-81517231 GTCTTACCGAATCACTGGTAGGG + Intronic
1102515625 12:113444369-113444391 GTCTTCCCACTTGCCTGGTGGGG + Intergenic
1112408336 13:99140404-99140426 GACTTCCTGCAACACAGGTGTGG - Intergenic
1114763517 14:25344685-25344707 GACTTCCCGCAACACTCCTGCGG + Intergenic
1115193555 14:30772429-30772451 GTCTTCCCACATTGCTGCTGAGG + Intergenic
1119900983 14:78259556-78259578 GGCTTCCAGCATCTCTTGTGTGG - Intronic
1121631219 14:95423101-95423123 GTCTTGCCTCCTCACTGGGGTGG + Intronic
1122672015 14:103379723-103379745 GTCTGCCCTCATCCCCGGTGTGG + Intergenic
1128982784 15:72198821-72198843 GTCTCCCCGCAGCACTGAAGGGG + Intergenic
1130287622 15:82569149-82569171 ATGTTCCCGCATTGCTGGTGAGG + Intronic
1131110464 15:89761531-89761553 GACTGCCCGCAACAGTGGTGAGG + Intronic
1132585403 16:704015-704037 CTCCTCCTGCACCACTGGTGGGG + Intronic
1133279869 16:4659242-4659264 CTCTCCCGGCATCACTGGCGTGG + Intronic
1138658029 16:58501783-58501805 GTCTTCTCCCAGCCCTGGTGTGG - Intronic
1144628996 17:16860718-16860740 TTCTTCCCGTTTCACAGGTGAGG + Intergenic
1144652417 17:17015396-17015418 TTCTTCCCGTTTCACAGGTGAGG - Intergenic
1145160570 17:20571284-20571306 TTCTTCCCGTTTCACAGGTGGGG + Intergenic
1147727218 17:42573574-42573596 TTCTTTCTGCATCTCTGGTGTGG + Exonic
1148823776 17:50377288-50377310 TTCTCCCCACATCACAGGTGGGG + Intronic
1151596173 17:75079168-75079190 GTCTTCCCACATCACGGGGCTGG + Intergenic
1151976776 17:77487847-77487869 GCCTTCCTGGAGCACTGGTGCGG + Intronic
1160263425 18:77317024-77317046 GATTTCCAGCATCACTGTTGGGG + Intergenic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1162018995 19:7860255-7860277 GTTTTCCGGGATCACTGGTGAGG - Intronic
1162213763 19:9114944-9114966 GTCTTCCCGAATTACTGCTGTGG - Exonic
1166531654 19:43546620-43546642 ATCTTCCTGGAGCACTGGTGAGG + Exonic
1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG + Intergenic
925506575 2:4572377-4572399 GTCTTCCCTCCACACTGGTCCGG + Intergenic
926092105 2:10057904-10057926 CTCTTCCTGCCTCACTGCTGTGG + Exonic
930345599 2:50176784-50176806 GTCTTCCCAAATCACTGCTCTGG + Intronic
931219646 2:60277652-60277674 ATCTTCCCCCAGCACTGTTGAGG - Intergenic
942483842 2:176418906-176418928 TTCTTCCAGCATCAGTGGTGTGG - Intergenic
1169318352 20:4611245-4611267 GTCTCCTCGTACCACTGGTGTGG - Intergenic
1171387608 20:24780771-24780793 TTCTTCCCCCAGCACGGGTGGGG - Intergenic
1184326635 22:43792649-43792671 TTCTTCCCACATCATAGGTGAGG + Intronic
954155329 3:48682073-48682095 GTCTCGGCGCTTCACTGGTGGGG + Exonic
956170919 3:66432713-66432735 TTCTGCCCGCTTCCCTGGTGAGG - Intronic
957458581 3:80487211-80487233 TTCTTCCAGCCTCACTGGGGAGG - Intergenic
960011857 3:112842224-112842246 GACTTCCCGCAACACTGCTGTGG - Intronic
961052338 3:123757510-123757532 GTCTTCCTCCATCCCTGATGTGG - Intronic
962698140 3:137971102-137971124 GTCTTCCCCCTTTACTAGTGTGG - Intergenic
967133602 3:186494799-186494821 ATCTTCCCCCATCACACGTGTGG + Intergenic
967465339 3:189798612-189798634 AACTTCCCCCATCTCTGGTGAGG - Intronic
968867672 4:3224201-3224223 GTCTTCCCGCATCACTGGTGTGG - Intronic
977614817 4:99076450-99076472 TGCTTCCCGGATCATTGGTGTGG - Exonic
986053902 5:4116855-4116877 ATCTTAGCTCATCACTGGTGAGG - Intergenic
988457490 5:31399257-31399279 GTCTCCTGGCATCACTGGTGGGG + Intergenic
989624281 5:43414597-43414619 GACTTCCTGCAACACTGGAGTGG - Intergenic
992417664 5:76567197-76567219 GTATTCCCACTTCACAGGTGAGG - Intronic
1034029677 7:147746683-147746705 GTTTTCTCCCATCACTGCTGTGG + Intronic
1035780648 8:2224723-2224745 CTCTTCGTGCATTACTGGTGAGG + Intergenic
1037104099 8:15083833-15083855 GTCTTCCCACCTCATTGCTGGGG + Intronic
1039965150 8:42278623-42278645 GTCTGCCTGCATCACTGGGACGG - Intronic
1040689788 8:49922442-49922464 GTCTGCCCTCATCAGTGGTGAGG - Intronic
1045773377 8:105772007-105772029 GTATTCCACCATCACTTGTGAGG - Intronic
1048898470 8:139015911-139015933 ATCTTCCAGCATCACGGCTGGGG + Intergenic
1049709074 8:144055646-144055668 GTGTGGCCGCAGCACTGGTGTGG - Intronic
1059687510 9:116651579-116651601 GATTTCCAGCAGCACTGGTGTGG + Exonic
1062521228 9:136958842-136958864 GTGTTCCCCCATCAGTGGTCAGG + Intergenic
1190597889 X:52065250-52065272 GTCTTCCTGCTTCACTGAAGGGG + Intronic
1190610935 X:52188823-52188845 GTCTTCCTGCTTCACTGAAGGGG - Intronic
1193011996 X:76687123-76687145 GTCTTCCTGCGTATCTGGTGTGG + Intergenic