ID: 968867926

View in Genome Browser
Species Human (GRCh38)
Location 4:3225615-3225637
Sequence CTTGATCTGCACAGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968867926_968867935 1 Left 968867926 4:3225615-3225637 CCTGCCCCCCTGTGCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 162
Right 968867935 4:3225639-3225661 CTCAGGGTGCTGGTGTTCACAGG 0: 1
1: 0
2: 0
3: 18
4: 280
968867926_968867934 -9 Left 968867926 4:3225615-3225637 CCTGCCCCCCTGTGCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 162
Right 968867934 4:3225629-3225651 CAGATCAAGACTCAGGGTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968867926 Original CRISPR CTTGATCTGCACAGGGGGGC AGG (reversed) Intronic
903349970 1:22711380-22711402 CTTGCTCCGCACAGGGTGGAGGG + Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
906860325 1:49352468-49352490 CTTAATCTGCACTGGGGTCCTGG + Intronic
907400193 1:54220470-54220492 GCTGATCTGCAAAGTGGGGCAGG + Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
914871302 1:151477042-151477064 CTTTATCTGCAAACAGGGGCAGG - Intergenic
915366831 1:155321431-155321453 CTGGATCTCCGAAGGGGGGCGGG - Intronic
915594910 1:156891236-156891258 CATTATCTGCAAAGGGGAGCAGG + Intergenic
916079862 1:161225819-161225841 CTGGAGCTGCAGAGGCGGGCAGG - Intergenic
920704424 1:208241473-208241495 CTGGAGCAGGACAGGGGGGCTGG - Intronic
1065800335 10:29346112-29346134 CAAGAACTGCACAGTGGGGCAGG + Intergenic
1067162629 10:43840225-43840247 ATTGAGCTGCACAGGGGTGAAGG + Intergenic
1067162801 10:43841808-43841830 ATTGAGCTGCACAGGGGTGAAGG + Intergenic
1071144274 10:82549422-82549444 CTGGGTCTGCACAGGGAGGTGGG + Intronic
1072724124 10:97801144-97801166 GTTGTTCTGCCCAGAGGGGCTGG + Intergenic
1076646276 10:131957205-131957227 CTTCATCTCCACAGGCGGACGGG - Intronic
1076646334 10:131957505-131957527 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646344 10:131957542-131957564 CTTCATCTCCACAGGGGCACGGG - Intronic
1076646360 10:131957615-131957637 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646371 10:131957652-131957674 CTTCATCTCCACAGTGGGACAGG - Intronic
1076646380 10:131957689-131957711 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646402 10:131957763-131957785 CTCCATCTCCACAGGGGCGCGGG - Intronic
1076646410 10:131957799-131957821 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646439 10:131957906-131957928 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646468 10:131958017-131958039 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646489 10:131958091-131958113 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646498 10:131958127-131958149 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646533 10:131958277-131958299 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646543 10:131958314-131958336 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646581 10:131958462-131958484 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646593 10:131958499-131958521 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646603 10:131958536-131958558 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646617 10:131958573-131958595 CTTCATCCCCACAGGGGGACAGG - Intronic
1076646633 10:131958647-131958669 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646642 10:131958684-131958706 CTTCATCTCCACAGGAGGACGGG - Intronic
1076646659 10:131958758-131958780 CTCCATCTCCACAGGGGGACGGG - Intronic
1076646670 10:131958795-131958817 CTCCATCTCCACAGGGGGACGGG - Intronic
1076646680 10:131958832-131958854 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646696 10:131958906-131958928 CTTTATCTCCACAGGGGGATGGG - Intronic
1076646706 10:131958943-131958965 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646722 10:131959017-131959039 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646732 10:131959054-131959076 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646748 10:131959128-131959150 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646759 10:131959165-131959187 CTTCATCTCCACAGGGGGACCGG - Intronic
1076646768 10:131959202-131959224 CTTCATCTCCACAGGAGGACGGG - Intronic
1076646776 10:131959239-131959261 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646802 10:131959350-131959372 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646818 10:131959424-131959446 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646829 10:131959461-131959483 CTTCATCTCCACAGGGGGACCGG - Intronic
1077231325 11:1459333-1459355 CTACATCTACACAGGGAGGCCGG - Intronic
1077404788 11:2378047-2378069 CTTGATGAGCTCATGGGGGCGGG - Intronic
1078915286 11:15773027-15773049 CTGGAACTGCACAGATGGGCAGG + Intergenic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1090621814 11:128567226-128567248 CTGGAACTGCACAGGAGGGACGG + Intronic
1091171529 11:133523897-133523919 CTTGATCTTGCCAGGGAGGCTGG - Intronic
1092766760 12:11860111-11860133 CGTGACCTGCACTGAGGGGCTGG - Intronic
1094352724 12:29544620-29544642 CTGGTTCTGCGCATGGGGGCGGG + Intronic
1096109568 12:49020835-49020857 CTCCATCTGGACATGGGGGCAGG - Exonic
1099230741 12:80021078-80021100 AGTGTTCTGCACAGGGGGGAAGG - Intergenic
1101331176 12:103759004-103759026 CCTGATCTCCACATGGAGGCAGG + Intronic
1102040327 12:109796699-109796721 AAAGATCTGCACAGGGGGCCAGG + Exonic
1103606201 12:122087706-122087728 GTTTATCTCCACAGGGCGGCTGG + Intronic
1104391057 12:128390815-128390837 GGTGATCTGCACAGGTGGCCTGG + Intronic
1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG + Intronic
1105472394 13:20704765-20704787 CGTACTCTGCACAGGGGGCCCGG + Intronic
1108696630 13:52907701-52907723 CTTGATCAGGACAGAGGGGAGGG - Intergenic
1110034817 13:70670031-70670053 CTTGATGTGCATAGAGGGACTGG - Intergenic
1113589511 13:111488689-111488711 CTTCCTCTGCACACGAGGGCAGG + Intergenic
1113639979 13:111950216-111950238 GTTGCTATGCACAGGGGAGCTGG + Intergenic
1114086124 14:19237904-19237926 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1115906930 14:38210905-38210927 CGTGATCTGCACTGGCGGGACGG - Exonic
1123054344 14:105562077-105562099 CGTGCCCTGCACAGGGGGACGGG - Intergenic
1123078928 14:105682496-105682518 CGTGCCCTGCACAGGGGGACGGG - Intergenic
1202897662 14_GL000194v1_random:19523-19545 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1123435323 15:20249914-20249936 TTCCATCTGCACAGGAGGGCAGG - Intergenic
1123696567 15:22883046-22883068 CTTCATCTGCACATGTGTGCGGG - Intronic
1123804966 15:23861137-23861159 CTTGAGCTGGACACTGGGGCGGG + Intergenic
1127256768 15:57299588-57299610 CCAGATCTGCCCAGGGAGGCTGG + Intergenic
1130258384 15:82336479-82336501 CTCGGTCAGCACAGCGGGGCTGG - Intergenic
1130596541 15:85253481-85253503 CTCGGTCAGCACAGCGGGGCTGG + Intergenic
1131053559 15:89362866-89362888 CCTGAGCTGCCCAAGGGGGCCGG - Intergenic
1132235414 15:100216487-100216509 CTTTATCTGCGCTGGGGGCCAGG + Intronic
1132533534 16:466122-466144 CTTGCTCTGCACAATGTGGCTGG + Intronic
1132851998 16:2028988-2029010 CTGGATCTGCAGAGAGGGGAAGG - Intronic
1135551836 16:23404577-23404599 AATGAACTGCACAGGGGGCCTGG - Intronic
1138559442 16:57791973-57791995 CCTGATCTGAACACGGGTGCAGG - Intronic
1139539030 16:67599974-67599996 CTTGGTGTGCTCAGGGGGGCTGG + Intronic
1139719497 16:68841193-68841215 CTAGAACTGCAGATGGGGGCCGG - Intergenic
1141110936 16:81270187-81270209 CTTGGTCTGCACAGGCTGCCTGG - Exonic
1142383300 16:89746288-89746310 CTTCATGTCCACAGGGGTGCAGG - Intronic
1142423008 16:89984364-89984386 CTCGGTCTGCACTGTGGGGCTGG + Intergenic
1144706450 17:17371471-17371493 CTAGATGTGCACATGGGAGCTGG + Intergenic
1145803534 17:27708415-27708437 ATTGATTTGCACAAGGGGGCAGG + Intergenic
1152246532 17:79187569-79187591 CTAGATCTCCACAGTGGGGTGGG + Intronic
1152611767 17:81318335-81318357 CTTGATCTGCATTGAGAGGCAGG - Intronic
1152991982 18:372007-372029 CTTGGTCTGCAGAGTGGAGCTGG + Intronic
1155316624 18:24578156-24578178 CTTGGTTTGCACAGGAAGGCGGG + Intergenic
1155393939 18:25366706-25366728 ATTGGTCTGCACAAGGGAGCCGG - Intergenic
1160579080 18:79873479-79873501 CTGGATGTGCTCAGAGGGGCCGG - Intronic
1160622705 18:80181781-80181803 CATGCTCTGCACAGGGGGAGAGG - Intronic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1165070398 19:33252005-33252027 CCTGCTCTGCCCAGGAGGGCAGG - Intergenic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
926931771 2:18048247-18048269 CTTGAACTGCACAGAGGGGGTGG - Intronic
929363851 2:41127456-41127478 CTTCTTCTTCACAGGGTGGCAGG + Intergenic
929731215 2:44494850-44494872 CTTGAGCTTCACAGAGTGGCAGG - Intronic
930503069 2:52247477-52247499 CTTGTCCTTCACAAGGGGGCAGG - Intergenic
932720357 2:74134369-74134391 CTCTATCTGCACAGTGGGGTTGG - Intronic
933724368 2:85418356-85418378 CTGGATCTGGACAGTGGGCCCGG - Intronic
934167088 2:89303788-89303810 CATGATCAGCACATGTGGGCTGG - Intergenic
934200189 2:89878666-89878688 CATGATCAGCACATGTGGGCTGG + Intergenic
937223796 2:120356844-120356866 CCTGCTCTGCACAGGAGGGGAGG - Intergenic
937538962 2:122925241-122925263 CTTAAACTGCATAAGGGGGCAGG + Intergenic
938210957 2:129465379-129465401 CTTGGTCTGGACAATGGGGCTGG - Intergenic
946758066 2:222966139-222966161 CTGGATCTGCCCATGGGAGCTGG - Intergenic
947834567 2:233166224-233166246 CATATTCTGCACAGCGGGGCAGG - Intronic
948360343 2:237415677-237415699 CTGGAGCTGCAGAGGGGAGCAGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1168910566 20:1443652-1443674 CTGGGTGTGCACAAGGGGGCAGG + Exonic
1175771860 20:61629054-61629076 TCTGATCTGCACAGGCAGGCAGG + Intronic
1176617346 21:9035512-9035534 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1176707794 21:10128157-10128179 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1180057921 21:45368572-45368594 CTTATTCTGCACAGGGAGGACGG + Intergenic
1180231531 21:46429437-46429459 CGTGAGGGGCACAGGGGGGCCGG + Intronic
1180291843 22:10855289-10855311 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1180494647 22:15884711-15884733 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1181314008 22:21960418-21960440 GTTGATATGCACAGGGATGCTGG + Exonic
1182078313 22:27510473-27510495 CTGGATGTGCACAGTGGTGCTGG + Intergenic
1182504825 22:30774131-30774153 CTTGGACTCCCCAGGGGGGCTGG + Intronic
1182516095 22:30859934-30859956 CTAGCTCTGCAGAGAGGGGCCGG - Intronic
1184333551 22:43840525-43840547 CAGGATCTGCTCAGGGGGCCTGG + Intronic
1184517237 22:44970261-44970283 CCTGCTCTGCACAGAAGGGCAGG + Intronic
1184978162 22:48077770-48077792 ATTTATATACACAGGGGGGCTGG + Intergenic
1185282231 22:49977841-49977863 CCTGCTCTGCAAAGGGCGGCAGG - Intergenic
954457145 3:50605938-50605960 CTTGCTCTGTGCAGTGGGGCAGG - Intergenic
961213630 3:125143616-125143638 CTTGACCTGCCCAGAGGGCCAGG + Intronic
961355833 3:126339445-126339467 CTCGATGTGCCCTGGGGGGCCGG - Intergenic
968867926 4:3225615-3225637 CTTGATCTGCACAGGGGGGCAGG - Intronic
970897585 4:21121233-21121255 CTTTTTCTGCATAAGGGGGCCGG - Intronic
973981425 4:56311281-56311303 TTTCATCTGCACAAGGGGCCAGG + Intronic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
979976795 4:127206922-127206944 CTTGATAAGCACAGGTGGGCAGG - Intergenic
980783843 4:137527215-137527237 TTTGATATCCACAGGGGGCCTGG - Intronic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
992720151 5:79552723-79552745 CTTGGTCAGCAAAGGTGGGCAGG - Intergenic
996474451 5:123900455-123900477 CTGGATCTGCACTGTGGGGCAGG + Intergenic
996978093 5:129459546-129459568 CTCTACCTGCACACGGGGGCAGG + Intergenic
997201068 5:132010671-132010693 CTGAATCTGCACATGGGGGTTGG + Intronic
999237637 5:150108738-150108760 GTGGATCTGCAAAGGGGAGCTGG + Intronic
999748067 5:154607297-154607319 CTTCTTCAGCACAGGTGGGCTGG - Intergenic
1001811950 5:174635647-174635669 ATTGAGGTGCACAGAGGGGCCGG - Intergenic
1003940614 6:11021791-11021813 TTTCATCTGCACACGGTGGCTGG + Intronic
1006946402 6:37787265-37787287 CTTGATCTGTACAGTGGAGCAGG - Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015973525 6:138766826-138766848 TTGGATGTGCACAGGTGGGCAGG - Intronic
1016759802 6:147724610-147724632 CAGGATCTCCACAGGGGGCCAGG - Intronic
1019127354 6:169849635-169849657 CTTCATCTGCCCAGGTGGACAGG - Intergenic
1019959605 7:4448223-4448245 GTTGCTTTGCACAGGGGGCCTGG + Intergenic
1022380792 7:29857866-29857888 CTTGATGTGCACAGTGGGAGAGG - Intronic
1025916527 7:65871059-65871081 CTTGCTCTGCCCAGGTGGGGTGG - Intergenic
1035038650 7:155911658-155911680 CTGGATCACCACAGGGAGGCCGG + Intergenic
1040598852 8:48865028-48865050 CCTGATCTGCCCAGGTGGGCGGG - Intergenic
1041350729 8:56945800-56945822 CTTCTTCTTCACAGGGAGGCAGG + Intergenic
1044311498 8:90698252-90698274 CTGGAAGTGCACAGGGGGTCTGG + Intronic
1047299837 8:123604122-123604144 TTTCAACTGCACAGGGGGTCAGG - Intergenic
1048722155 8:137337729-137337751 CTTGAGTTGACCAGGGGGGCTGG - Intergenic
1051251679 9:15165650-15165672 CTTCTTCTTCACAGGGCGGCAGG + Exonic
1051349405 9:16184957-16184979 CTTGGTCTGCTCATGGGGGAGGG - Intergenic
1051589058 9:18757604-18757626 CTTGACCAGCACAGGGGAGTGGG - Intronic
1052660152 9:31419195-31419217 CTTTATAGGCACAGGGGGGCAGG - Intergenic
1053023028 9:34708845-34708867 CTTTAACTGCTCAGGGGTGCAGG + Intergenic
1053418945 9:37964794-37964816 CTTCATCTGTACAGTGGGGGCGG - Intronic
1053760993 9:41349957-41349979 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1056475589 9:86948131-86948153 CTTGATCACCACAGAGGGGAAGG + Intergenic
1059391200 9:114000730-114000752 CTTCACCTGCACGGAGGGGCTGG + Intronic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060886688 9:127159499-127159521 CTCGGTCTGCAGAAGGGGGCAGG - Intronic
1061395784 9:130342715-130342737 GCTGATGGGCACAGGGGGGCAGG - Intronic
1202792539 9_KI270719v1_random:97037-97059 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1185666620 X:1770308-1770330 ATTGATATGAGCAGGGGGGCTGG + Intergenic
1187414482 X:19081362-19081384 ATTGATCTGCACTGCAGGGCTGG + Intronic
1202233252 Y:22678329-22678351 ATTGATATGGACAGGGGGGCAGG + Intergenic
1202309904 Y:23517829-23517851 ATTGATATGGACAGGGGGGCAGG - Intergenic
1202560897 Y:26152764-26152786 ATTGATATGGACAGGGGGGCAGG + Intergenic