ID: 968867945

View in Genome Browser
Species Human (GRCh38)
Location 4:3225702-3225724
Sequence ATGCTCCCCAGCTCCCGCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968867945_968867948 -3 Left 968867945 4:3225702-3225724 CCCGAGCGGGAGCTGGGGAGCAT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 968867948 4:3225722-3225744 CATGAGCTACAAACTCGGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
968867945_968867947 -8 Left 968867945 4:3225702-3225724 CCCGAGCGGGAGCTGGGGAGCAT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 968867947 4:3225717-3225739 GGGAGCATGAGCTACAAACTCGG 0: 1
1: 0
2: 0
3: 3
4: 94
968867945_968867950 22 Left 968867945 4:3225702-3225724 CCCGAGCGGGAGCTGGGGAGCAT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 968867950 4:3225747-3225769 AGTCTCGCGCCCCCGCCGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968867945 Original CRISPR ATGCTCCCCAGCTCCCGCTC GGG (reversed) Exonic
900013730 1:135669-135691 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
900043800 1:491652-491674 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
900065237 1:726655-726677 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
900110701 1:1004324-1004346 ATGGTCCCCAACTCCTGCCCAGG + Intergenic
900113854 1:1020460-1020482 TCGCTCCGCAGCCCCCGCTCCGG + Intronic
902526062 1:17058312-17058334 AGGCTCCCCGGCTCCCCCGCGGG + Intergenic
902548446 1:17205160-17205182 TGGCTCCCCAGCTCCCGTCCTGG - Exonic
903944119 1:26951175-26951197 CCTCTCCCCAGCTCCCACTCTGG - Intronic
903966828 1:27095972-27095994 AACCTCCCCGGCTCCCTCTCTGG + Intergenic
904872967 1:33633433-33633455 CGGCTCCTCAGCTCCCTCTCGGG - Exonic
905120646 1:35679296-35679318 AGGATCCCCAGCTTCTGCTCAGG - Intergenic
906293909 1:44637339-44637361 ACACTCTCCAGCTCCGGCTCAGG - Intronic
907426367 1:54381817-54381839 ATGCTTCCCAGCATCCCCTCAGG - Intronic
911169456 1:94755944-94755966 AATCTCCCCAGCTCCAGCACTGG - Intergenic
911793925 1:102053513-102053535 ACTCTCCCCAGCTCCAGCTCTGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
914257483 1:145972408-145972430 ATGCTCCCCTGCTCCCTTTTAGG + Intronic
915274072 1:154776070-154776092 CTGGTCCCCAGCTGCCTCTCAGG + Intronic
920388033 1:205581642-205581664 ATGCTCCCCACCCCCGGCCCAGG - Intronic
922734606 1:227972443-227972465 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1062857049 10:784668-784690 CTGCCCCCCACCTCCCGCCCCGG + Intergenic
1063203797 10:3811411-3811433 ACTCTCCCCAGCTCCCGAGCTGG - Intergenic
1066733150 10:38451264-38451286 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1068653937 10:59555141-59555163 ATGCTCTCCAGTTCCCTCTCAGG - Intergenic
1069902896 10:71716068-71716090 GTGAGCCCCAGCTCCGGCTCTGG - Exonic
1073099403 10:100999134-100999156 GTGCTCCCCAGCCTCCCCTCGGG - Intronic
1073238198 10:102036021-102036043 ACGCTCCCCACCTCCCAGTCGGG - Intronic
1073441419 10:103555089-103555111 AGCCTCCCCACCTCCCGCGCTGG - Intronic
1074399058 10:113126793-113126815 ATGCTGCCCAGGGCCCGCGCCGG - Intronic
1075096870 10:119477736-119477758 AACCTGCCCAGCTCCCTCTCTGG - Intergenic
1075648660 10:124113083-124113105 GTGCTCCCCTGCCCCCGCCCGGG - Intergenic
1076234993 10:128856595-128856617 ATGCTGCCCTGCTCCTGCCCAGG + Intergenic
1076287136 10:129311361-129311383 ACCCTCCCCAGCTCCCTCTCTGG - Intergenic
1076970074 11:127883-127905 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
1077675064 11:4187828-4187850 ACCCACCCCAGCCCCCGCTCAGG - Intergenic
1078541624 11:12217815-12217837 AGGCTCCTCAGCACCAGCTCAGG - Intronic
1078905749 11:15686428-15686450 CTGCTCCCCACCTCCCGGACGGG + Intergenic
1080265158 11:30392697-30392719 ATGCTCCTGAGCTCCAGCTCAGG - Intronic
1080889618 11:36398151-36398173 ATGTTCCCCAGCTCCCACCTAGG - Intronic
1081613906 11:44579333-44579355 CAGCTTCCCAGCTCCTGCTCTGG - Intronic
1081702117 11:45158666-45158688 CTGCTCCCCAGCTCCCGTCAGGG - Intronic
1082233741 11:49798430-49798452 CTGCCCCCCACCTCCCGGTCGGG + Intergenic
1083605235 11:63974771-63974793 ATGATCCCAAGCTTCCCCTCCGG - Exonic
1089029045 11:115303741-115303763 ATGCTTCCCATCTCCCGGTAGGG - Intronic
1089890302 11:121874034-121874056 ATCCACCCCAGCTGCCCCTCTGG - Intergenic
1090399213 11:126438060-126438082 ATGCTCCCCAGGCCCCTTTCTGG - Intronic
1091357052 11:134945172-134945194 TGGCTCCACACCTCCCGCTCCGG + Intergenic
1091440834 12:510950-510972 ATTCTCCCCACCTCCAGCACTGG + Intronic
1091916528 12:4274462-4274484 ATGCTCCCCTACCCCCGCCCAGG - Intronic
1092038688 12:5363996-5364018 ATGTGCCCCGGCTCCCGCTGAGG - Intergenic
1092820583 12:12350194-12350216 ATGCTCCGCAGCTCCCGCACCGG + Exonic
1095184343 12:39184550-39184572 ATGCTCCTCTGCTGCCGCTGGGG - Intergenic
1098023053 12:66174839-66174861 ATGCTCCCCAGTTCCCAGACGGG - Intergenic
1098162290 12:67657274-67657296 ATGCTGTCCAGCTGCCGCTCTGG - Exonic
1102045037 12:109824424-109824446 ATGCTACTCAGCTCCAGCCCAGG + Intronic
1102727950 12:115081944-115081966 ATGCTACCCAGCTCTCCCTTTGG - Intergenic
1102795711 12:115687359-115687381 AGCCTCCCCAGCTCTTGCTCTGG - Intergenic
1102896268 12:116600720-116600742 TTACACCCCAGCACCCGCTCAGG + Intergenic
1104591364 12:130086654-130086676 ATGATTCTCAGCTCCCGCCCTGG + Intergenic
1105754381 13:23451487-23451509 ATGGTTCCCACCTCCCGGTCTGG + Intergenic
1107984269 13:45761518-45761540 CTACTCCACAGCTCCAGCTCAGG - Intergenic
1113729935 13:112634166-112634188 GTGCACCCCAGCTCCTGCACTGG - Intergenic
1114559030 14:23577911-23577933 ATTCTGCCCAGCCCCCTCTCAGG - Exonic
1114683755 14:24508170-24508192 ATACTCACCAGCTTCAGCTCTGG + Exonic
1117591059 14:57268737-57268759 CGGCTCGCCAGCTCCGGCTCCGG + Exonic
1118621842 14:67620558-67620580 CTCCTCCCCACCTCCCGCGCTGG - Intronic
1121485708 14:94312823-94312845 CTCCTCCCCAGCTCTCTCTCAGG - Intronic
1122133041 14:99617041-99617063 AAGCTCCCCAGCTTCTGCTCTGG - Intergenic
1122182663 14:99967291-99967313 ATGCTCACCCGCTCCCGCCCTGG + Intergenic
1122700072 14:103582258-103582280 ATGCCCCCCAGCTATGGCTCAGG - Intronic
1123036940 14:105475365-105475387 GTGACCCCCAGCTCCCACTCCGG + Intronic
1123112313 14:105878772-105878794 TGGCCCCCCAGCGCCCGCTCCGG + Intergenic
1124365387 15:29067479-29067501 AGGCTCCCCTACTCCCACTCAGG - Intronic
1124414693 15:29465415-29465437 AAGCTCCCCATCCCCAGCTCAGG + Intronic
1124963264 15:34413811-34413833 AGGCTCCCCCACTCCCACTCAGG - Intronic
1124979884 15:34560037-34560059 AGGCTCCCCCACTCCCACTCAGG - Intronic
1125604496 15:40932306-40932328 TTGTTCCCCAGCTGCCGCCCAGG + Exonic
1128249612 15:66155252-66155274 ATGCCCCCCACCCCCCGCTATGG + Intronic
1128737009 15:70059076-70059098 ATGCTCTCCAGCTCCTCCTCAGG + Intronic
1129781865 15:78277626-78277648 ATGCTTCCCAGCCCCGGCTCAGG - Intronic
1134883611 16:17770290-17770312 ATGCTCCACCGCTCCCTCTGGGG - Intergenic
1139678234 16:68539747-68539769 TTTCTCCCCAGCTCCTGCCCCGG + Exonic
1140343412 16:74188274-74188296 CTGCCCCCCGGCTCCCACTCTGG - Intergenic
1141557009 16:84842920-84842942 ATGCTTCCCGCCTCCCGGTCTGG + Intronic
1141992290 16:87617537-87617559 ATGACCCCCAGCTTCCTCTCTGG - Intronic
1142450603 16:90171249-90171271 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1142456959 17:62442-62464 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
1142886916 17:2918588-2918610 TTGCTCTCTTGCTCCCGCTCTGG - Intronic
1143520195 17:7440310-7440332 AATCTCCCCAGCTCTCCCTCGGG + Intronic
1143697371 17:8630510-8630532 GTCTTCCCCAGCTCCCGCTTCGG + Intronic
1148822496 17:50367693-50367715 AAGCTCCCCTCCTCCCCCTCTGG + Intergenic
1149464195 17:56861650-56861672 ATGCTCCCTACCTCTCACTCAGG - Intronic
1149682031 17:58513788-58513810 GTCCTCCCCTCCTCCCGCTCTGG - Intronic
1151459385 17:74245655-74245677 CTGCTCCCCATCTCGCACTCAGG - Intronic
1152744326 17:82032005-82032027 ATGCTGCCCGGCTCCCGCTTGGG + Intronic
1153977823 18:10284941-10284963 CTGCTCCCCAGCTGTCCCTCAGG - Intergenic
1154016970 18:10627358-10627380 ATGCTCTCCAGCACCCACACTGG + Intergenic
1154187890 18:12202245-12202267 ATGCTCTCCAGCACCCACACTGG - Intergenic
1155167511 18:23243351-23243373 ATGCTCCTCAGCTACTGCCCAGG - Intronic
1155218369 18:23662742-23662764 AAGCGCGCCGGCTCCCGCTCGGG - Exonic
1157484294 18:48076017-48076039 TTCCTCCCCAGCGCCTGCTCAGG + Intronic
1159032272 18:63243634-63243656 ATTCTCTCCTGCTCCCACTCCGG + Intronic
1160258473 18:77267313-77267335 ATGCTCCCCAGCCCATGCACTGG - Intronic
1160433070 18:78825531-78825553 CTGCTCCCCACCTCCTGCCCTGG - Intergenic
1160646872 19:197801-197823 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
1160935542 19:1592824-1592846 GCGCTCGCCAGCCCCCGCTCGGG + Intergenic
1163591043 19:18194250-18194272 ATGCTCTCAACCTCCCGCCCAGG - Intronic
1163644102 19:18478602-18478624 AGGCTCCCCAGCTCCCACCTGGG - Intronic
1165373596 19:35425872-35425894 CAGCTCCCCAGCTCCAGCCCAGG - Intergenic
1166648536 19:44552179-44552201 AGGCTCTCCAGCTCCCAGTCTGG - Intergenic
1167151738 19:47713942-47713964 ATTCTCCCCAGCTCTCTCTCAGG + Intronic
1168351761 19:55680063-55680085 ATGCTCCCCAGCAGACTCTCAGG - Intronic
925894646 2:8461933-8461955 AAGCTCCCAAGCTCCCACTGTGG - Intergenic
927492094 2:23527333-23527355 ATGCTGCCCAGCCCCCACCCTGG - Intronic
928289773 2:30026907-30026929 ACAAACCCCAGCTCCCGCTCTGG - Intergenic
932432808 2:71685772-71685794 ATGTTCCCCAGCGCCGGCTGGGG - Intronic
933046301 2:77540928-77540950 ATGCTCTCTATCTCCTGCTCTGG + Intronic
934942629 2:98513609-98513631 CTGCTCCCAAGCATCCGCTCAGG - Intronic
936037693 2:109126071-109126093 CTGCTGCCCAGCTCCAGCCCTGG - Intergenic
936251941 2:110874059-110874081 ATCCTCCCCGGCTCTTGCTCTGG - Intronic
937014477 2:118591657-118591679 CTGATCCGCAGCTCCTGCTCAGG - Intergenic
937145485 2:119640770-119640792 ACACACCCCAGCTCCCACTCGGG + Intronic
938295209 2:130173729-130173751 CTGCTGCCCAGCTCCCTCTGAGG + Intronic
939039705 2:137173297-137173319 TTCCTCCCCAGCTCCAGCTAAGG + Intronic
939608357 2:144279818-144279840 ATACTCCCTAGCCCCTGCTCTGG - Intronic
942072781 2:172330332-172330354 ATGGTCCCCAGATACCCCTCAGG + Intergenic
944570857 2:201042685-201042707 CTGCCCCCCAGCTCCCGGACTGG - Intronic
945470690 2:210225055-210225077 GTGCTCCCCAACTCCGGCGCCGG - Intronic
945616121 2:212069479-212069501 ATGCTTCCCCACTCCCGATCAGG + Intronic
946447334 2:219751181-219751203 CTGCTCCCCACCTCCCGGACGGG + Intergenic
947501549 2:230674806-230674828 CTGCACCCCAGCTCCCACTGGGG - Intergenic
947815684 2:233034746-233034768 AGCTTCCCCAGCCCCCGCTCGGG + Exonic
947841197 2:233208905-233208927 ATGCTCCCCGTCACCTGCTCTGG + Intergenic
948449516 2:238060659-238060681 CTGCTCCTCAGGTCCAGCTCGGG + Intronic
948899327 2:240948178-240948200 ATGCTACTCTGCTCCCTCTCCGG - Intronic
1168757374 20:326468-326490 ATCCTCCACAGCTCCCGCCCCGG - Exonic
1171401019 20:24873028-24873050 AAGCACCCCAGCTCCCGTGCTGG + Intergenic
1171941032 20:31330218-31330240 ATGTCCCCCAGCTCCAGCTGAGG + Intergenic
1172612973 20:36265456-36265478 TGGCTCCCCAGCTCCGGCCCAGG + Intronic
1174207377 20:48850515-48850537 AGACTCCCCAGCCCCAGCTCAGG - Intergenic
1175103732 20:56598941-56598963 ATGCTCCCCAGCACCCCAGCTGG - Intergenic
1175171212 20:57082680-57082702 ATGCTCACCAGCTCCCCTCCTGG - Intergenic
1175711755 20:61226965-61226987 ATGTGCTCCAGCTCCCGCTGAGG + Intergenic
1176163823 20:63662630-63662652 AGGCTCCTGGGCTCCCGCTCCGG + Intronic
1178396332 21:32246798-32246820 GTCTGCCCCAGCTCCCGCTCTGG - Intergenic
1180716559 22:17876531-17876553 ATCCTCTCCAGCTCCCTCTGGGG - Intronic
1181114536 22:20622924-20622946 CTGCTGCCCAGCTCCCTCTGAGG + Intergenic
1181514373 22:23402688-23402710 GTGCTCCCCAGCCCCAGCCCGGG - Intergenic
1182802707 22:33044693-33044715 ACTCTCCCCAGCTCCCCCTAGGG + Intronic
1183590594 22:38777311-38777333 CTGCTCCCCACCTCCAGCGCCGG + Intronic
1183655009 22:39179548-39179570 ACCCTCCCCGGCTCCTGCTCCGG - Intergenic
1184479089 22:44736780-44736802 CTCCTCCGCCGCTCCCGCTCGGG + Exonic
950467109 3:13162121-13162143 ATGTTCACTAGCCCCCGCTCAGG + Intergenic
954291513 3:49652434-49652456 AGGCTCTCCATCTCCAGCTCAGG - Exonic
967975898 3:195034737-195034759 AAGCCCCCCAGCTCCTGCCCAGG + Intergenic
967980618 3:195063045-195063067 ATGCTCCCGCGCTCCTGCACAGG + Intergenic
968287587 3:197517799-197517821 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287601 3:197517853-197517875 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287616 3:197517907-197517929 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287631 3:197517962-197517984 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287645 3:197518016-197518038 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287688 3:197518179-197518201 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287702 3:197518233-197518255 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287765 3:197518449-197518471 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287796 3:197518557-197518579 ATGGTCTCCATCTCCCCCTCAGG + Intronic
968287931 3:197519024-197519046 ATGGTCTCCATCCCCCGCTCAGG + Intronic
968370809 3:198221721-198221743 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
968534756 4:1116987-1117009 AAGCTCTCCAGCTCCCTCTTTGG + Intergenic
968810114 4:2795951-2795973 ATGCTCCCTACCACCCCCTCTGG - Intronic
968867945 4:3225702-3225724 ATGCTCCCCAGCTCCCGCTCGGG - Exonic
975121648 4:70735231-70735253 ATACTCTCCACCTCCCCCTCAGG - Intronic
977790430 4:101094010-101094032 CTTCTCCCCAGCTACAGCTCAGG + Intronic
979259486 4:118634212-118634234 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
979357077 4:119716624-119716646 GTGCTCCCCTGCTTCCGCTAGGG - Intergenic
981300950 4:143185251-143185273 AGGCTCGCTAGCTCCCGCCCCGG + Exonic
982194518 4:152897269-152897291 CTTCTCCCCAGCACCCACTCAGG - Intronic
984632856 4:182078726-182078748 CTGCTCCCCACCCCCAGCTCAGG - Intergenic
990293919 5:54381553-54381575 ATGCTCCCCACCTCCCAGACGGG - Intergenic
996101870 5:119452619-119452641 ATGCTCACCTGCCCCCGCGCCGG - Exonic
996884850 5:128342622-128342644 CTCCTTCCCAGCTCCTGCTCTGG - Intronic
1001156866 5:169280119-169280141 AAGCTGCCCAGCTTCCGCTGGGG + Intronic
1001325441 5:170720412-170720434 ATCTTGCCCAGCTCCCTCTCTGG + Intronic
1002730043 5:181327277-181327299 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1003500161 6:6696558-6696580 CAGCTCCCCAGCTCCCACTCTGG - Intergenic
1003659640 6:8048275-8048297 ATCCTCTCCATCTCCTGCTCTGG + Intronic
1005453045 6:25992542-25992564 ATGCTCCCCGGCTCCCAGCCAGG + Intergenic
1007048776 6:38804494-38804516 CTTCTCCCCAGCTGCTGCTCAGG + Intronic
1007485033 6:42175041-42175063 CTGCTCACCTGCTCCCGCTTCGG - Intronic
1007521634 6:42454572-42454594 GTCCTAGCCAGCTCCCGCTCAGG - Intergenic
1007599952 6:43075522-43075544 ATGGGCCCCAGCTGCTGCTCAGG - Intergenic
1008955730 6:57213920-57213942 ATGCACCCCAACTCCCTCTATGG + Intronic
1009913724 6:69966179-69966201 GTGCCCCCCACCTCCCGCACGGG - Intronic
1011419317 6:87155339-87155361 CTGCTGCCCACTTCCCGCTCGGG + Intronic
1017488823 6:154926365-154926387 ATGTTCCCCAGCTCACACTTGGG + Intronic
1018455269 6:163946100-163946122 TTCCTCCCCAGCTCCTCCTCAGG - Intergenic
1018980842 6:168600505-168600527 CTGCTTCCCAGCTGCCACTCGGG - Intronic
1019617987 7:1975200-1975222 AGGCTCCCCAGGTCCTGCCCTGG + Intronic
1019998520 7:4740965-4740987 ATGCTCCGGAGGTCCGGCTCCGG - Exonic
1020157315 7:5736931-5736953 GTGCTCCCCACCTCCCGGACGGG - Intronic
1020586635 7:10078479-10078501 TTGCTCCCCAGCTACAGCTGTGG + Intergenic
1022318124 7:29263915-29263937 CTGCCCCCCAGCTCCCGGACAGG - Intronic
1022801509 7:33781148-33781170 ATCATCCCCAGCTCCCTCTATGG - Intergenic
1023401214 7:39793836-39793858 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1024648401 7:51386845-51386867 AAGCTCCCCAGGCCCAGCTCCGG - Intergenic
1024648933 7:51388918-51388940 AAGCTCCCCAGGCCCAGCTCCGG - Intergenic
1025176267 7:56803977-56803999 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025177626 7:56810035-56810057 AAGCTCCCCAGCCCCAGCTCAGG - Intergenic
1025177796 7:56810740-56810762 ATCCTCCCCAGGCCCAGCTCCGG - Intergenic
1025178226 7:56812506-56812528 AAGCTCCCCAGGCCCAGCTCGGG - Intergenic
1025180920 7:56823593-56823615 AAGCTCCCCAGGCCCAGCTCAGG - Intronic
1025181347 7:56825333-56825355 AAGCTCCCCAGGCCCAGCTCAGG - Intronic
1025690124 7:63749824-63749846 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025690571 7:63751647-63751669 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025691020 7:63753470-63753492 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025691455 7:63755246-63755268 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025691895 7:63757069-63757091 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025692343 7:63758892-63758914 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025692787 7:63760715-63760737 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025693204 7:63762394-63762416 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025693647 7:63764217-63764239 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025694130 7:63766204-63766226 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1025695525 7:63772445-63772467 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic
1026494301 7:70889094-70889116 GTGCTTCCCATCTCCAGCTCCGG - Intergenic
1027265842 7:76494858-76494880 CTGCTCTCCAGCTCTGGCTCCGG - Intronic
1027317214 7:76992975-76992997 CTGCTCTCCAGCTCTGGCTCCGG - Intergenic
1029374614 7:100170301-100170323 ATGCCCCCCCACTCCTGCTCCGG + Exonic
1032051712 7:128654201-128654223 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1033449476 7:141449694-141449716 TTGCTCCCCAGCTCTCGATCTGG - Intronic
1034720394 7:153286878-153286900 ATGCCGACCAGCTCCTGCTCAGG - Intergenic
1034978883 7:155463329-155463351 ATGCTCACCAGCAGCCGCCCAGG + Exonic
1035219670 7:157398554-157398576 ATGTTCCGCAGCTGCCGCGCGGG - Intronic
1035438492 7:158877557-158877579 ATGATGCCCAGCTCCTGCTTAGG - Intronic
1036772254 8:11587315-11587337 GTGCTCCCCGGATCCCGCTGGGG - Intergenic
1038167966 8:25103167-25103189 CTGCCCCCCACCTCCCGCACGGG - Intergenic
1039205761 8:35152238-35152260 AAGCTCCCCAGGTCCAGCTGAGG - Intergenic
1041066250 8:54085672-54085694 ATGCTCCTCACCTCCCGGACGGG - Intronic
1044931683 8:97257958-97257980 ATGCTCCACAGCTCCCAATAGGG + Intergenic
1045028961 8:98117192-98117214 CTGCCCCACAGCTCCCGCTGGGG + Exonic
1048845764 8:138602583-138602605 ATGCTCCCCACCTCTCTGTCCGG + Intronic
1048973356 8:139657431-139657453 GTCCTCCCCGGCTCCTGCTCTGG - Intronic
1049487655 8:142874908-142874930 ATGCTGCCCAGACCCCGCCCAGG + Intronic
1053071613 9:35105354-35105376 AGGTTCCGGAGCTCCCGCTCAGG - Exonic
1054814813 9:69465054-69465076 ATGCTACCCAGAGCCCGTTCAGG - Intronic
1055580473 9:77702809-77702831 CTGCCCCCCAGCTCCCGGACGGG + Intergenic
1055580492 9:77702851-77702873 CTGCCCCCCAGCTCCCGGACGGG + Intergenic
1056434531 9:86562732-86562754 ATGCTGCCCAGCTCTCCCTTAGG + Intergenic
1059284052 9:113157645-113157667 ATGCTCTCCAGCACCTCCTCTGG - Intronic
1060724922 9:126000304-126000326 ATGCTCCCCACCCCCAGCTCTGG - Intergenic
1060822949 9:126671976-126671998 ATGCTCCCGAGCCCCAGCTGTGG + Intronic
1061098688 9:128475591-128475613 ATGCCCCCCAGTTCCATCTCTGG + Intronic
1061523509 9:131137831-131137853 ATGAGCCACAGCTCCCGGTCTGG + Intronic
1062078313 9:134604285-134604307 GTGTTCCCAAGCTCCCACTCTGG + Intergenic
1062116929 9:134814591-134814613 AGGCTCCTCAGGTCCCCCTCAGG + Intronic
1062754458 9:138279791-138279813 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1203578362 Un_KI270745v1:23951-23973 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1189310382 X:40013913-40013935 AGATTCCACAGCTCCCGCTCCGG + Intergenic
1192899945 X:75486288-75486310 ATGGTCCCCAGCTCCAGCCCAGG + Intronic
1195888974 X:109671397-109671419 CTGCCCCCCAGCTCCCGGGCGGG - Intronic
1196759383 X:119187674-119187696 CTGCTCCACAGCTCCCACACTGG + Intergenic
1200068107 X:153514579-153514601 CTGCTTCCCAGCTCCCTCCCAGG - Intergenic
1200164251 X:154025289-154025311 ACAACCCCCAGCTCCCGCTCCGG - Intronic
1200218926 X:154381088-154381110 AGGATCGCCAGGTCCCGCTCTGG + Exonic
1202381002 Y:24276578-24276600 AAGCTCCCCAGGCCCAGCTCAGG + Intergenic
1202489783 Y:25393548-25393570 AAGCTCCCCAGGCCCAGCTCAGG - Intergenic